Introduction
============

Bowtie 2 is an ultrafast and memory-efficient tool for aligning
sequencing reads to long reference sequences. It is particularly good at
aligning reads of about 50 up to 100s of characters to relatively long
(e.g. mammalian) genomes. Bowtie 2 indexes the genome with an FM Index
(based on the Burrows-Wheeler Transform or BWT) to keep its memory
footprint small: for the human genome, its memory footprint is typically
around 3.2 gigabytes of RAM. Bowtie 2 supports gapped, local, and
paired-end alignment modes. Multiple processors can be used
simultaneously to achieve greater alignment speed.

Bowtie 2 outputs alignments in SAM format, enabling interoperation with
a large number of other tools (e.g. SAMtools, GATK) that use SAM. Bowtie
2 is distributed under the GPLv3 license, and it runs on the command
line under Windows, Mac OS X and Linux and BSD.

Bowtie 2 is often the first step in pipelines for comparative genomics,
including for variation calling, ChIP-seq, RNA-seq, BS-seq. Bowtie 2 and
Bowtie (also called "Bowtie 1" here) are also tightly integrated into
many other tools, some of which are listed here.

If you use Bowtie 2 for your published research, please cite our work.
Papers describing Bowtie 2 are:

-   Langmead B, Wilks C, Antonescu V, Charles R. Scaling read aligners
    to hundreds of threads on general-purpose processors.
    Bioinformatics. 2018 Jul 18. doi: 10.1093/bioinformatics/bty648.

-   Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2.
    Nature Methods. 2012 Mar 4;9(4):357-9. doi: 10.1038/nmeth.1923.

How is Bowtie 2 different from Bowtie 1?
----------------------------------------

Bowtie 1 was released in 2009 and was geared toward aligning the
relatively short sequencing reads (up to 25-50 nucleotides) prevalent at
the time. Since then, technology has improved both sequencing throughput
(more nucleotides produced per sequencer per day) and read length (more
nucleotides per read).

The chief differences between Bowtie 1 and Bowtie 2 are:

1.  For reads longer than about 50 bp Bowtie 2 is generally faster, more
    sensitive, and uses less memory than Bowtie 1. For relatively short
    reads (e.g. less than 50 bp) Bowtie 1 is sometimes faster and/or
    more sensitive.

2.  Bowtie 2 supports gapped alignment with affine gap penalties. Number
    of gaps and gap lengths are not restricted, except by way of the
    configurable scoring scheme. Bowtie 1 finds just ungapped
    alignments.

3.  Bowtie 2 supports local alignment, which doesn't require reads to
    align end-to-end. Local alignments might be "trimmed" ("soft
    clipped") at one or both extremes in a way that optimizes alignment
    score. Bowtie 2 also supports end-to-end alignment which, like
    Bowtie 1, requires that the read align entirely.

4.  There is no upper limit on read length in Bowtie 2. Bowtie 1 had an
    upper limit of around 1000 bp.

5.  Bowtie 2 allows alignments to overlap ambiguous characters (e.g. Ns)
    in the reference. Bowtie 1 does not.

6.  Bowtie 2 does away with Bowtie 1's notion of alignment "stratum",
    and its distinction between "Maq-like" and "end-to-end" modes. In
    Bowtie 2 all alignments lie along a continuous spectrum of alignment
    scores where the scoring scheme, similar to Needleman-Wunsch and
    Smith-Waterman.

7.  Bowtie 2's paired-end alignment is more flexible. E.g. for pairs
    that do not align in a paired fashion, Bowtie 2 attempts to find
    unpaired alignments for each mate.

8.  Bowtie 2 reports a spectrum of mapping qualities, in contrast for
    Bowtie 1 which reports either 0 or high.

9.  Bowtie 2 does not align colorspace reads.

Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Bowtie 2's
command-line arguments and genome index format are both different from
Bowtie 1's.

What isn't Bowtie 2?
--------------------

Bowtie 2 is geared toward aligning relatively short sequencing reads to
long genomes. That said, it handles arbitrarily small reference
sequences (e.g. amplicons) and very long reads (i.e. upwards of 10s or
100s of kilobases), though it is slower in those settings. It is
optimized for the read lengths and error modes yielded by typical
Illumina sequencers.

Bowtie 2 does not support alignment of colorspace reads. (Bowtie 1
does.)

Obtaining Bowtie 2
==================

Bowtie 2 is available from various package managers, notably Bioconda.
With Bioconda installed, you should be able to install Bowtie 2 with
conda install bowtie2.

You can also download Bowtie 2 sources and binaries from the Download
section of the Sourceforge site. Binaries are available for the x86_64
architecture running Linux, Mac OS X, and Windows. FreeBSD users can
obtain the latest version of Bowtie 2 from ports using
pkg install bowtie2. If you plan to compile Bowtie 2 yourself, make sure
to get the source package, i.e., the filename that ends in
"-source.zip".

Building from source
--------------------

Building from source

Building Bowtie 2 from source requires a GNU-like environment with
Clang/GCC, GNU Make and other basics. It should be possible to build
Bowtie 2 on most vanilla *NIX installations or on a Mac installation
with Xcode installed. Bowtie 2 can also be built on Windows using a
64-bit MinGW distribution and MSYS. In order to simplify the MinGW setup
it might be worth investigating popular MinGW personal builds since
these are coming already prepared with most of the toolchains needed.

First, download the source package from the sourceforge site. Make sure
you're getting the source package; the file downloaded should end in
-source.zip. Unzip the file, change to the unzipped directory, and build
the Bowtie 2 tools by running GNU make (usually with the command make,
but sometimes with gmake) with no arguments. If building with MinGW, run
make from the MSYS environment.

The Bowtie 2 Makefile also includes recipes for basic automatic
dependency management. Running make static-libs && make STATIC_BUILD=1
will issue a series of commands that will: 1. download zstd and zlib 2.
compile them as static libraries 3. link the resulting libraries to the
compiled Bowtie 2 binaries

As of version 2.3.5 bowtie2 now supports aligning SRA reads. Prepackaged
builds will include a package that supports SRA. If you're building
bowtie2 from source please make sure that the Java runtime is available
on your system. You can then proceed with the build by running
make sra-deps && make USE_SRA=1.

Adding to PATH
--------------

By adding your new Bowtie 2 directory to your PATH environment variable,
you ensure that whenever you run bowtie2, bowtie2-build or
bowtie2-inspect from the command line, you will get the version you just
installed without having to specify the entire path. This is recommended
for most users. To do this, follow your operating system's instructions
for adding the directory to your PATH.

If you would like to install Bowtie 2 by copying the Bowtie 2 executable
files to an existing directory in your PATH, make sure that you copy all
the executables, including bowtie2, bowtie2-align-s, bowtie2-align-l,
bowtie2-build, bowtie2-build-s, bowtie2-build-l, bowtie2-inspect,
bowtie2-inspect-s and bowtie2-inspect-l.

The bowtie2 aligner
===================

bowtie2 takes a Bowtie 2 index and a set of sequencing read files and
outputs a set of alignments in SAM format.

"Alignment" is the process by which we discover how and where the read
sequences are similar to the reference sequence. An "alignment" is a
result from this process, specifically: an alignment is a way of "lining
up" some or all of the characters in the read with some characters from
the reference in a way that reveals how they're similar. For example:

      Read:      GACTGGGCGATCTCGACTTCG
                 |||||  |||||||||| |||
      Reference: GACTG--CGATCTCGACATCG

Where dash symbols represent gaps and vertical bars show where aligned
characters match.

We use alignment to make an educated guess as to where a read originated
with respect to the reference genome. It's not always possible to
determine this with certainty. For instance, if the reference genome
contains several long stretches of As (AAAAAAAAA etc.) and the read
sequence is a short stretch of As (AAAAAAA), we cannot know for certain
exactly where in the sea of As the read originated.

End-to-end alignment versus local alignment
-------------------------------------------

By default, Bowtie 2 performs end-to-end read alignment. That is, it
searches for alignments involving all of the read characters. This is
also called an "untrimmed" or "unclipped" alignment.

When the --local option is specified, Bowtie 2 performs local read
alignment. In this mode, Bowtie 2 might "trim" or "clip" some read
characters from one or both ends of the alignment if doing so maximizes
the alignment score.

End-to-end alignment example

The following is an "end-to-end" alignment because it involves all the
characters in the read. Such an alignment can be produced by Bowtie 2 in
either end-to-end mode or in local mode.

    Read:      GACTGGGCGATCTCGACTTCG
    Reference: GACTGCGATCTCGACATCG

    Alignment:
      Read:      GACTGGGCGATCTCGACTTCG
                 |||||  |||||||||| |||
      Reference: GACTG--CGATCTCGACATCG

Local alignment example

The following is a "local" alignment because some of the characters at
the ends of the read do not participate. In this case, 4 characters are
omitted (or "soft trimmed" or "soft clipped") from the beginning and 3
characters are omitted from the end. This sort of alignment can be
produced by Bowtie 2 only in local mode.

    Read:      ACGGTTGCGTTAATCCGCCACG
    Reference: TAACTTGCGTTAAATCCGCCTGG

    Alignment:
      Read:      ACGGTTGCGTTAA-TCCGCCACG
                     ||||||||| ||||||
      Reference: TAACTTGCGTTAAATCCGCCTGG

Scores: higher = more similar
-----------------------------

An alignment score quantifies how similar the read sequence is to the
reference sequence aligned to. The higher the score, the more similar
they are. A score is calculated by subtracting penalties for each
difference (mismatch, gap, etc.) and, in local alignment mode, adding
bonuses for each match.

The scores can be configured with the --ma (match bonus), --mp (mismatch
penalty), --np (penalty for having an N in either the read or the
reference), --rdg (affine read gap penalty) and --rfg (affine reference
gap penalty) options.

End-to-end alignment score example

A mismatched base at a high-quality position in the read receives a
penalty of -6 by default. A length-2 read gap receives a penalty of -11
by default (-5 for the gap open, -3 for the first extension, -3 for the
second extension). Thus, in end-to-end alignment mode, if the read is 50
bp long and it matches the reference exactly except for one mismatch at
a high-quality position and one length-2 read gap, then the overall
score is -(6 + 11) = -17.

The best possible alignment score in end-to-end mode is 0, which happens
when there are no differences between the read and the reference.

Local alignment score example

A mismatched base at a high-quality position in the read receives a
penalty of -6 by default. A length-2 read gap receives a penalty of -11
by default (-5 for the gap open, -3 for the first extension, -3 for the
second extension). A base that matches receives a bonus of +2 be
default. Thus, in local alignment mode, if the read is 50 bp long and it
matches the reference exactly except for one mismatch at a high-quality
position and one length-2 read gap, then the overall score equals the
total bonus, 2 * 49, minus the total penalty, 6 + 11, = 81.

The best possible score in local mode equals the match bonus times the
length of the read. This happens when there are no differences between
the read and the reference.

Valid alignments meet or exceed the minimum score threshold

For an alignment to be considered "valid" (i.e. "good enough") by Bowtie
2, it must have an alignment score no less than the minimum score
threshold. The threshold is configurable and is expressed as a function
of the read length. In end-to-end alignment mode, the default minimum
score threshold is -0.6 + -0.6 * L, where L is the read length. In local
alignment mode, the default minimum score threshold is 20 + 8.0 * ln(L),
where L is the read length. This can be configured with the --score-min
option. For details on how to set options like --score-min that
correspond to functions, see the section on setting function options.

Mapping quality: higher = more unique
-------------------------------------

The aligner cannot always assign a read to its point of origin with high
confidence. For instance, a read that originated inside a repeat element
might align equally well to many occurrences of the element throughout
the genome, leaving the aligner with no basis for preferring one over
the others.

Aligners characterize their degree of confidence in the point of origin
by reporting a mapping quality: a non-negative integer Q = -10 log10 p,
where p is an estimate of the probability that the alignment does not
correspond to the read's true point of origin. Mapping quality is
sometimes abbreviated MAPQ, and is recorded in the SAM MAPQ field.

Mapping quality is related to "uniqueness." We say an alignment is
unique if it has a much higher alignment score than all the other
possible alignments. The bigger the gap between the best alignment's
score and the second-best alignment's score, the more unique the best
alignment, and the higher its mapping quality should be.

Accurate mapping qualities are useful for downstream tools like variant
callers. For instance, a variant caller might choose to ignore evidence
from alignments with mapping quality less than, say, 10. A mapping
quality of 10 or less indicates that there is at least a 1 in 10 chance
that the read truly originated elsewhere.

Aligning pairs
--------------

A "paired-end" or "mate-pair" read consists of pair of mates, called
mate 1 and mate 2. Pairs come with a prior expectation about (a) the
relative orientation of the mates, and (b) the distance separating them
on the original DNA molecule. Exactly what expectations hold for a given
dataset depends on the lab procedures used to generate the data. For
example, a common lab procedure for producing pairs is Illumina's
Paired-end Sequencing Assay, which yields pairs with a relative
orientation of FR ("forward, reverse") meaning that if mate 1 came from
the Watson strand, mate 2 very likely came from the Crick strand and
vice versa. Also, this protocol yields pairs where the expected genomic
distance from end to end is about 200-500 base pairs.

For simplicity, this manual uses the term "paired-end" to refer to any
pair of reads with some expected relative orientation and distance.
Depending on the protocol, these might actually be referred to as
"paired-end" or "mate-paired." Also, we always refer to the individual
sequences making up the pair as "mates."

Paired inputs

Pairs are often stored in a pair of files, one file containing the mate
1s and the other containing the mates 2s. The first mate in the file for
mate 1 forms a pair with the first mate in the file for mate 2, the
second with the second, and so on. When aligning pairs with Bowtie 2,
specify the file with the mate 1s mates using the -1 argument and the
file with the mate 2s using the -2 argument. This causes Bowtie 2 to
take the paired nature of the reads into account when aligning them.

Paired SAM output

When Bowtie 2 prints a SAM alignment for a pair, it prints two records
(i.e. two lines of output), one for each mate. The first record
describes the alignment for mate 1 and the second record describes the
alignment for mate 2. In both records, some of the fields of the SAM
record describe various properties of the alignment; for instance, the
7th and 8th fields (RNEXT and PNEXT respectively) indicate the reference
name and position where the other mate aligned, and the 9th field
indicates the inferred length of the DNA fragment from which the two
mates were sequenced. See the SAM specification for more details
regarding these fields.

Concordant pairs match pair expectations, discordant pairs don't

A pair that aligns with the expected relative mate orientation and with
the expected range of distances between mates is said to align
"concordantly". If both mates have unique alignments, but the alignments
do not match paired-end expectations (i.e. the mates aren't in the
expected relative orientation, or aren't within the expected distance
range, or both), the pair is said to align "discordantly". Discordant
alignments may be of particular interest, for instance, when seeking
structural variants.

The expected relative orientation of the mates is set using the --ff,
--fr, or --rf options. The expected range of inter-mates distances (as
measured from the furthest extremes of the mates; also called "outer
distance") is set with the -I and -X options. Note that setting -I and
-X far apart makes Bowtie 2 slower. See documentation for -I and -X.

To declare that a pair aligns discordantly, Bowtie 2 requires that both
mates align uniquely. This is a conservative threshold, but this is
often desirable when seeking structural variants.

By default, Bowtie 2 searches for both concordant and discordant
alignments, though searching for discordant alignments can be disabled
with the --no-discordant option.

Mixed mode: paired where possible, unpaired otherwise

If Bowtie 2 cannot find a paired-end alignment for a pair, by default it
will go on to look for unpaired alignments for the constituent mates.
This is called "mixed mode." To disable mixed mode, set the --no-mixed
option.

Bowtie 2 runs a little faster in --no-mixed mode, but will only consider
alignment status of pairs per se, not individual mates.

Some SAM FLAGS describe paired-end properties

The SAM FLAGS field, the second field in a SAM record, has multiple bits
that describe the paired-end nature of the read and alignment. The first
(least significant) bit (1 in decimal, 0x1 in hexadecimal) is set if the
read is part of a pair. The second bit (2 in decimal, 0x2 in
hexadecimal) is set if the read is part of a pair that aligned in a
paired-end fashion. The fourth bit (8 in decimal, 0x8 in hexadecimal) is
set if the read is part of a pair and the other mate in the pair had at
least one valid alignment. The sixth bit (32 in decimal, 0x20 in
hexadecimal) is set if the read is part of a pair and the other mate in
the pair aligned to the Crick strand (or, equivalently, if the reverse
complement of the other mate aligned to the Watson strand). The seventh
bit (64 in decimal, 0x40 in hexadecimal) is set if the read is mate 1 in
a pair. The eighth bit (128 in decimal, 0x80 in hexadecimal) is set if
the read is mate 2 in a pair. See the SAM specification for a more
detailed description of the FLAGS field.

Some SAM optional fields describe more paired-end properties

The last several fields of each SAM record usually contain SAM optional
fields, which are simply tab-separated strings conveying additional
information about the reads and alignments. A SAM optional field is
formatted like this: "XP:i:1" where "XP" is the TAG, "i" is the TYPE
("integer" in this case), and "1" is the VALUE. See the SAM
specification for details regarding SAM optional fields.

Mates can overlap, contain, or dovetail each other

The fragment and read lengths might be such that alignments for the two
mates from a pair overlap each other. Consider this example:

(For these examples, assume we expect mate 1 to align to the left of
mate 2.)

    Mate 1:    GCAGATTATATGAGTCAGCTACGATATTGTT
    Mate 2:                               TGTTTGGGGTGACACATTACGCGTCTTTGAC
    Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

It's also possible, though unusual, for one mate alignment to contain
the other, as in these examples:

    Mate 1:    GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGC
    Mate 2:                               TGTTTGGGGTGACACATTACGC
    Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

    Mate 1:                   CAGCTACGATATTGTTTGGGGTGACACATTACGC
    Mate 2:                      CTACGATATTGTTTGGGGTGAC
    Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

And it's also possible, though unusual, for the mates to "dovetail",
with the mates seemingly extending "past" each other as in this example:

    Mate 1:                 GTCAGCTACGATATTGTTTGGGGTGACACATTACGC
    Mate 2:            TATGAGTCAGCTACGATATTGTTTGGGGTGACACAT                   
    Reference: GCAGATTATATGAGTCAGCTACGATATTGTTTGGGGTGACACATTACGCGTCTTTGAC

In some situations, it's desirable for the aligner to consider all these
cases as "concordant" as long as other paired-end constraints are not
violated. Bowtie 2's default behavior is to consider overlapping and
containing as being consistent with concordant alignment. By default,
dovetailing is considered inconsistent with concordant alignment.

These defaults can be overridden. Setting --no-overlap causes Bowtie 2
to consider overlapping mates as non-concordant. Setting --no-contain
causes Bowtie 2 to consider cases where one mate alignment contains the
other as non-concordant. Setting --dovetail causes Bowtie 2 to consider
cases where the mate alignments dovetail as concordant.

Reporting
---------

The reporting mode governs how many alignments Bowtie 2 looks for, and
how to report them. Bowtie 2 has three distinct reporting modes. The
default reporting mode is similar to the default reporting mode of many
other read alignment tools, including BWA. It is also similar to Bowtie
1's -M alignment mode.

In general, when we say that a read has an alignment, we mean that it
has a valid alignment. When we say that a read has multiple alignments,
we mean that it has multiple alignments that are valid and distinct from
one another.

Distinct alignments map a read to different places

Two alignments for the same individual read are "distinct" if they map
the same read to different places. Specifically, we say that two
alignments are distinct if there are no alignment positions where a
particular read offset is aligned opposite a particular reference offset
in both alignments with the same orientation. E.g. if the first
alignment is in the forward orientation and aligns the read character at
read offset 10 to the reference character at chromosome 3, offset
3,445,245, and the second alignment is also in the forward orientation
and also aligns the read character at read offset 10 to the reference
character at chromosome 3, offset 3,445,245, they are not distinct
alignments.

Two alignments for the same pair are distinct if either the mate 1s in
the two paired-end alignments are distinct or the mate 2s in the two
alignments are distinct or both.

Default mode: search for multiple alignments, report the best one

By default, Bowtie 2 searches for distinct, valid alignments for each
read. When it finds a valid alignment, it generally will continue to
look for alignments that are nearly as good or better. It will
eventually stop looking, either because it exceeded a limit placed on
search effort (see -D and -R) or because it already knows all it needs
to know to report an alignment. Information from the best alignments are
used to estimate mapping quality (the MAPQ SAM field) and to set SAM
optional fields, such as AS:i and XS:i. Bowtie 2 does not guarantee that
the alignment reported is the best possible in terms of alignment score.

See also: -D, which puts an upper limit on the number of dynamic
programming problems (i.e. seed extensions) that can "fail" in a row
before Bowtie 2 stops searching. Increasing -D makes Bowtie 2 slower,
but increases the likelihood that it will report the correct alignment
for a read that aligns many places.

See also: -R, which sets the maximum number of times Bowtie 2 will
"re-seed" when attempting to align a read with repetitive seeds.
Increasing -R makes Bowtie 2 slower, but increases the likelihood that
it will report the correct alignment for a read that aligns many places.

-k mode: search for one or more alignments, report each

In -k mode, Bowtie 2 searches for up to N distinct, valid alignments for
each read, where N equals the integer specified with the -k parameter.
That is, if -k 2 is specified, Bowtie 2 will search for at most 2
distinct alignments. It reports all alignments found, in descending
order by alignment score. The alignment score for a paired-end alignment
equals the sum of the alignment scores of the individual mates. Each
reported read or pair alignment beyond the first has the SAM 'secondary'
bit (which equals 256) set in its FLAGS field. Supplementary alignments
will also be assigned a MAPQ of 255. See the SAM specification for
details.

Bowtie 2 does not "find" alignments in any specific order, so for reads
that have more than N distinct, valid alignments, Bowtie 2 does not
guarantee that the N alignments reported are the best possible in terms
of alignment score. Still, this mode can be effective and fast in
situations where the user cares more about whether a read aligns (or
aligns a certain number of times) than where exactly it originated.

-a mode: search for and report all alignments

-a mode is similar to -k mode except that there is no upper limit on the
number of alignments Bowtie 2 should report. Alignments are reported in
descending order by alignment score. The alignment score for a
paired-end alignment equals the sum of the alignment scores of the
individual mates. Each reported read or pair alignment beyond the first
has the SAM 'secondary' bit (which equals 256) set in its FLAGS field.
Supplementary alignments will be assigned a MAPQ of 255. See the SAM
specification for details.

Some tools are designed with this reporting mode in mind. Bowtie 2 is
not! For very large genomes, this mode is very slow.

Randomness in Bowtie 2

Bowtie 2's search for alignments for a given read is "randomized." That
is, when Bowtie 2 encounters a set of equally-good choices, it uses a
pseudo-random number to choose. For example, if Bowtie 2 discovers a set
of 3 equally-good alignments and wants to decide which to report, it
picks a pseudo-random integer 0, 1 or 2 and reports the corresponding
alignment. Arbitrary choices can crop up at various points during
alignment.

The pseudo-random number generator is re-initialized for every read, and
the seed used to initialize it is a function of the read name,
nucleotide string, quality string, and the value specified with --seed.
If you run the same version of Bowtie 2 on two reads with identical
names, nucleotide strings, and quality strings, and if --seed is set the
same for both runs, Bowtie 2 will produce the same output; i.e., it will
align the read to the same place, even if there are multiple equally
good alignments. This is intuitive and desirable in most cases. Most
users expect Bowtie to produce the same output when run twice on the
same input.

However, when the user specifies the --non-deterministic option, Bowtie
2 will use the current time to re-initialize the pseudo-random number
generator. When this is specified, Bowtie 2 might report different
alignments for identical reads. This is counter-intuitive for some
users, but might be more appropriate in situations where the input
consists of many identical reads.

Multiseed heuristic
-------------------

To rapidly narrow the number of possible alignments that must be
considered, Bowtie 2 begins by extracting substrings ("seeds") from the
read and its reverse complement and aligning them in an ungapped fashion
with the help of the FM Index. This is "multiseed alignment" and it is
similar to what Bowtie 1 does, except Bowtie 1 attempts to align the
entire read this way.

This initial step makes Bowtie 2 much faster than it would be without
such a filter, but at the expense of missing some valid alignments. For
instance, it is possible for a read to have a valid overall alignment
but to have no valid seed alignments because each potential seed
alignment is interrupted by too many mismatches or gaps.

The trade-off between speed and sensitivity/accuracy can be adjusted by
setting the seed length (-L), the interval between extracted seeds (-i),
and the number of mismatches permitted per seed (-N). For more sensitive
alignment, set these parameters to (a) make the seeds closer together,
(b) make the seeds shorter, and/or (c) allow more mismatches. You can
adjust these options one-by-one, though Bowtie 2 comes with some useful
combinations of options prepackaged as "preset options."

-D and -R are also options that adjust the trade-off between speed and
sensitivity/accuracy.

FM Index memory footprint

Bowtie 2 uses the FM Index to find ungapped alignments for seeds. This
step accounts for the bulk of Bowtie 2's memory footprint, as the FM
Index itself is typically the largest data structure used. For instance,
the memory footprint of the FM Index for the human genome is about 3.2
gigabytes of RAM.

Ambiguous characters
--------------------

Non-whitespace characters besides A, C, G or T are considered
"ambiguous." N is a common ambiguous character that appears in reference
sequences. Bowtie 2 considers all ambiguous characters in the reference
(including IUPAC nucleotide codes) to be Ns.

Bowtie 2 allows alignments to overlap ambiguous characters in the
reference. An alignment position that contains an ambiguous character in
the read, reference, or both, is penalized according to --np. --n-ceil
sets an upper limit on the number of positions that may contain
ambiguous reference characters in a valid alignment. The optional field
XN:i reports the number of ambiguous reference characters overlapped by
an alignment.

Note that the multiseed heuristic cannot find seed alignments that
overlap ambiguous reference characters. For an alignment overlapping an
ambiguous reference character to be found, it must have one or more seed
alignments that do not overlap ambiguous reference characters.

Presets: setting many settings at once
--------------------------------------

Bowtie 2 comes with some useful combinations of parameters packaged into
shorter "preset" parameters. For example, running Bowtie 2 with the
--very-sensitive option is the same as running with options:
-D 20 -R 3 -N 0 -L 20 -i S,1,0.50. The preset options that come with
Bowtie 2 are designed to cover a wide area of the
speed/sensitivity/accuracy trade-off space, with the presets ending in
fast generally being faster but less sensitive and less accurate, and
the presets ending in sensitive generally being slower but more
sensitive and more accurate. See the documentation for the preset
options for details.

As of Bowtie2 v2.4.0, individual preset values can be overridden by
providing the specific options e.g. the configured seed length of 20 in
the [--very-senitive] preset above can be changed to 25 by also
specifying the -L 25 parameter anywhere on the command line.

Filtering
---------

Some reads are skipped or "filtered out" by Bowtie 2. For example, reads
may be filtered out because they are extremely short or have a high
proportion of ambiguous nucleotides. Bowtie 2 will still print a SAM
record for such a read, but no alignment will be reported and the YF:i
SAM optional field will be set to indicate the reason the read was
filtered.

-   YF:Z:LN: the read was filtered because it had length less than or
    equal to the number of seed mismatches set with the -N option.
-   YF:Z:NS: the read was filtered because it contains a number of
    ambiguous characters (usually N or .) greater than the ceiling
    specified with --n-ceil.
-   YF:Z:SC: the read was filtered because the read length and the match
    bonus (set with --ma) are such that the read can't possibly earn an
    alignment score greater than or equal to the threshold set with
    --score-min
-   YF:Z:QC: the read was filtered because it was marked as failing
    quality control and the user specified the --qc-filter option. This
    only happens when the input is in Illumina's QSEQ format (i.e. when
    --qseq is specified) and the last (11th) field of the read's QSEQ
    record contains 1.

If a read could be filtered for more than one reason, the value YF:Z
flag will reflect only one of those reasons.

Alignment summary
-----------------

When Bowtie 2 finishes running, it prints messages summarizing what
happened. These messages are printed to the "standard error" ("stderr")
filehandle. For datasets consisting of unpaired reads, the summary might
look like this:

    20000 reads; of these:
      20000 (100.00%) were unpaired; of these:
        1247 (6.24%) aligned 0 times
        18739 (93.69%) aligned exactly 1 time
        14 (0.07%) aligned >1 times
    93.77% overall alignment rate

For datasets consisting of pairs, the summary might look like this:

    10000 reads; of these:
      10000 (100.00%) were paired; of these:
        650 (6.50%) aligned concordantly 0 times
        8823 (88.23%) aligned concordantly exactly 1 time
        527 (5.27%) aligned concordantly >1 times
        ----
        650 pairs aligned concordantly 0 times; of these:
          34 (5.23%) aligned discordantly 1 time
        ----
        616 pairs aligned 0 times concordantly or discordantly; of these:
          1232 mates make up the pairs; of these:
            660 (53.57%) aligned 0 times
            571 (46.35%) aligned exactly 1 time
            1 (0.08%) aligned >1 times
    96.70% overall alignment rate

The indentation indicates how subtotals relate to totals.

Wrapper scripts
---------------

The bowtie2, bowtie2-build and bowtie2-inspect executables are actually
wrapper scripts that call binary programs as appropriate. The wrappers
shield users from having to distinguish between "small" and "large"
index formats, discussed briefly in the following section. Also, the
bowtie2 wrapper provides some key functionality, like the ability to
handle compressed inputs, and the functionality for --un, --al and
related options.

It is recommended that you always run the bowtie2 wrappers and not run
the binaries directly.

Small and large indexes
-----------------------

bowtie2-build can index reference genomes of any size. For genomes less
than about 4 billion nucleotides in length, bowtie2-build builds a
"small" index using 32-bit numbers in various parts of the index. When
the genome is longer, bowtie2-build builds a "large" index using 64-bit
numbers. Small indexes are stored in files with the .bt2 extension, and
large indexes are stored in files with the .bt2l extension. The user
need not worry about whether a particular index is small or large; the
wrapper scripts will automatically build and use the appropriate index.

Performance tuning
------------------

1.  If your computer has multiple processors/cores, use -p

    The -p option causes Bowtie 2 to launch a specified number of
    parallel search threads. Each thread runs on a different
    processor/core and all threads find alignments in parallel,
    increasing alignment throughput by approximately a multiple of the
    number of threads (though in practice, speedup is somewhat worse
    than linear).

2.  If reporting many alignments per read, try reducing
    bowtie2-build --offrate

    If you are using -k or -a options and Bowtie 2 is reporting many
    alignments per read, using an index with a denser SA sample can
    speed things up considerably. To do this, specify a
    smaller-than-default -o/--offrate value when running bowtie2-build.
    A denser SA sample yields a larger index, but is also particularly
    effective at speeding up alignment when many alignments are reported
    per read.

3.  If bowtie2 "thrashes", try increasing bowtie2-build --offrate

    If bowtie2 runs very slowly on a relatively low-memory computer, try
    setting -o/--offrate to a larger value when building the index. This
    decreases the memory footprint of the index.

Command Line
------------

Setting function options

Some Bowtie 2 options specify a function rather than an individual
number or setting. In these cases the user specifies three parameters:
(a) a function type F, (b) a constant term B, and (c) a coefficient A.
The available function types are constant (C), linear (L), square-root
(S), and natural log (G). The parameters are specified as F,B,A - that
is, the function type, the constant term, and the coefficient are
separated by commas with no whitespace. The constant term and
coefficient may be negative and/or floating-point numbers.

For example, if the function specification is L,-0.4,-0.6, then the
function defined is:

    f(x) = -0.4 + -0.6 * x

If the function specification is G,1,5.4, then the function defined is:

    f(x) = 1.0 + 5.4 * ln(x)

See the documentation for the option in question to learn what the
parameter x is for. For example, in the case if the --score-min option,
the function f(x) sets the minimum alignment score necessary for an
alignment to be considered valid, and x is the read length.

Usage

    bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> | -U <r> | --interleaved <i> | --sra-acc <acc> | b <bam>} -S [<sam>]

Main arguments

    -x <bt2-idx>

The basename of the index for the reference genome. The basename is the
name of any of the index files up to but not including the final .1.bt2
/ .rev.1.bt2 / etc. bowtie2 looks for the specified index first in the
current directory, then in the directory specified in the
BOWTIE2_INDEXES environment variable.

    -1 <m1>

Comma-separated list of files containing mate 1s (filename usually
includes _1), e.g. -1 flyA_1.fq,flyB_1.fq. Sequences specified with this
option must correspond file-for-file and read-for-read with those
specified in <m2>. Reads may be a mix of different lengths. If - is
specified, bowtie2 will read the mate 1s from the "standard in" or
"stdin" filehandle.

    -2 <m2>

Comma-separated list of files containing mate 2s (filename usually
includes _2), e.g. -2 flyA_2.fq,flyB_2.fq. Sequences specified with this
option must correspond file-for-file and read-for-read with those
specified in <m1>. Reads may be a mix of different lengths. If - is
specified, bowtie2 will read the mate 2s from the "standard in" or
"stdin" filehandle.

    -U <r>

Comma-separated list of files containing unpaired reads to be aligned,
e.g. lane1.fq,lane2.fq,lane3.fq,lane4.fq. Reads may be a mix of
different lengths. If - is specified, bowtie2 gets the reads from the
"standard in" or "stdin" filehandle.

    --interleaved

Reads interleaved FASTQ files where the first two records (8 lines)
represent a mate pair.

    --sra-acc

Reads are SRA accessions. If the accession provided cannot be found in
local storage it will be fetched from the NCBI database. If you find
that SRA alignments are long running please rerun your command with the
-p/--threads parameter set to desired number of threads.

NB: this option is only available if bowtie 2 is compiled with the
necessary SRA libraries. See Obtaining Bowtie 2 for details.

    -b <bam>

Reads are unaligned BAM records sorted by read name. The
--align-paired-reads and --preserve-tags options affect the way Bowtie 2
processes records.

    -S <sam>

File to write SAM alignments to. By default, alignments are written to
the "standard out" or "stdout" filehandle (i.e. the console).

Options

Input options

    -q

Reads (specified with <m1>, <m2>, <s>) are FASTQ files. FASTQ files
usually have extension .fq or .fastq. FASTQ is the default format. See
also: --solexa-quals and --int-quals.

    --tab5

Each read or pair is on a single line. An unpaired read line is
[name]\t[seq]\t[qual]\n. A paired-end read line is
[name]\t[seq1]\t[qual1]\t[seq2]\t[qual2]\n. An input file can be a mix
of unpaired and paired-end reads and Bowtie 2 recognizes each according
to the number of fields, handling each as it should.

    --tab6

Similar to --tab5 except, for paired-end reads, the second end can have
a different name from the first:
[name1]\t[seq1]\t[qual1]\t[name2]\t[seq2]\t[qual2]\n

    --qseq

Reads (specified with <m1>, <m2>, <s>) are QSEQ files. QSEQ files
usually end in _qseq.txt. See also: --solexa-quals and --int-quals.

    -f

Reads (specified with <m1>, <m2>, <s>) are FASTA files. FASTA files
usually have extension .fa, .fasta, .mfa, .fna or similar. FASTA files
do not have a way of specifying quality values, so when -f is set, the
result is as if --ignore-quals is also set.

    -r

Reads (specified with <m1>, <m2>, <s>) are files with one input sequence
per line, without any other information (no read names, no qualities).
When -r is set, the result is as if --ignore-quals is also set.

    -F k:<int>,i:<int>

Reads are substrings (k-mers) extracted from a FASTA file <s>.
Specifically, for every reference sequence in FASTA file <s>, Bowtie 2
aligns the k-mers at offsets 1, 1+i, 1+2i, ... until reaching the end of
the reference. Each k-mer is aligned as a separate read. Quality values
are set to all Is (40 on Phred scale). Each k-mer (read) is given a name
like <sequence>_<offset>, where <sequence> is the name of the FASTA
sequence it was drawn from and <offset> is its 0-based offset of origin
with respect to the sequence. Only single k-mers, i.e. unpaired reads,
can be aligned in this way.
    -c

The read sequences are given on command line. I.e. <m1>, <m2> and
<singles> are comma-separated lists of reads rather than lists of read
files. There is no way to specify read names or qualities, so -c also
implies --ignore-quals.

    -s/--skip <int>

Skip (i.e. do not align) the first <int> reads or pairs in the input.

    -u/--qupto <int>

Align the first <int> reads or read pairs from the input (after the
-s/--skip reads or pairs have been skipped), then stop. Default: no
limit.

    -5/--trim5 <int>

Trim <int> bases from 5' (left) end of each read before alignment
(default: 0).

    -3/--trim3 <int>

Trim <int> bases from 3' (right) end of each read before alignment
(default: 0).

    --trim-to [3:|5:]<int>

Trim reads exceeding <int> bases. Bases will be trimmed from either the
3' (right) or 5' (left) end of the read. If the read end if not
specified, bowtie 2 will default to trimming from the 3' (right) end of
the read. --trim-to and -3/-5 are mutually exclusive.

    --phred33

Input qualities are ASCII chars equal to the Phred quality plus 33. This
is also called the "Phred+33" encoding, which is used by the very latest
Illumina pipelines.

    --phred64

Input qualities are ASCII chars equal to the Phred quality plus 64. This
is also called the "Phred+64" encoding.

    --solexa-quals

Convert input qualities from Solexa (which can be negative) to Phred
(which can't). This scheme was used in older Illumina GA Pipeline
versions (prior to 1.3). Default: off.

    --int-quals

Quality values are represented in the read input file as space-separated
ASCII integers, e.g., 40 40 30 40..., rather than ASCII characters,
e.g., II?I.... Integers are treated as being on the Phred quality scale
unless --solexa-quals is also specified. Default: off.

Preset options in --end-to-end mode

    --very-fast

Same as: -D 5 -R 1 -N 0 -L 22 -i S,0,2.50

    --fast

Same as: -D 10 -R 2 -N 0 -L 22 -i S,0,2.50

    --sensitive

Same as: -D 15 -R 2 -N 0 -L 22 -i S,1,1.15 (default in --end-to-end
mode)

    --very-sensitive

Same as: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50

Preset options in --local mode

    --very-fast-local

Same as: -D 5 -R 1 -N 0 -L 25 -i S,1,2.00

    --fast-local

Same as: -D 10 -R 2 -N 0 -L 22 -i S,1,1.75

    --sensitive-local

Same as: -D 15 -R 2 -N 0 -L 20 -i S,1,0.75 (default in --local mode)

    --very-sensitive-local

Same as: -D 20 -R 3 -N 0 -L 20 -i S,1,0.50

Alignment options

    -N <int>

Sets the number of mismatches to allowed in a seed alignment during
multiseed alignment. Can be set to 0 or 1. Setting this higher makes
alignment slower (often much slower) but increases sensitivity. Default:
0.

    -L <int>

Sets the length of the seed substrings to align during multiseed
alignment. Smaller values make alignment slower but more sensitive.
Default: the --sensitive preset is used by default, which sets -L to 22
and 20 in --end-to-end mode and in --local mode.

    -i <func>

Sets a function governing the interval between seed substrings to use
during multiseed alignment. For instance, if the read has 30 characters,
and seed length is 10, and the seed interval is 6, the seeds extracted
will be:

    Read:      TAGCTACGCTCTACGCTATCATGCATAAAC
    Seed 1 fw: TAGCTACGCT
    Seed 1 rc: AGCGTAGCTA
    Seed 2 fw:       CGCTCTACGC
    Seed 2 rc:       GCGTAGAGCG
    Seed 3 fw:             ACGCTATCAT
    Seed 3 rc:             ATGATAGCGT
    Seed 4 fw:                   TCATGCATAA
    Seed 4 rc:                   TTATGCATGA

Since it's best to use longer intervals for longer reads, this parameter
sets the interval as a function of the read length, rather than a single
one-size-fits-all number. For instance, specifying -i S,1,2.5 sets the
interval function f to f(x) = 1 + 2.5 * sqrt(x), where x is the read
length. See also: setting function options. If the function returns a
result less than 1, it is rounded up to 1. Default: the --sensitive
preset is used by default, which sets -i to S,1,1.15 in --end-to-end
mode to -i S,1,0.75 in --local mode.

    --n-ceil <func>

Sets a function governing the maximum number of ambiguous characters
(usually Ns and/or .s) allowed in a read as a function of read length.
For instance, specifying -L,0,0.15 sets the N-ceiling function f to
f(x) = 0 + 0.15 * x, where x is the read length. See also: setting
function options. Reads exceeding this ceiling are filtered out.
Default: L,0,0.15.

    --dpad <int>

"Pads" dynamic programming problems by <int> columns on either side to
allow gaps. Default: 15.

    --gbar <int>

Disallow gaps within <int> positions of the beginning or end of the
read. Default: 4.

    --ignore-quals

When calculating a mismatch penalty, always consider the quality value
at the mismatched position to be the highest possible, regardless of the
actual value. I.e. input is treated as though all quality values are
high. This is also the default behavior when the input doesn't specify
quality values (e.g. in -f, -r, or -c modes).

    --nofw/--norc

If --nofw is specified, bowtie2 will not attempt to align unpaired reads
to the forward (Watson) reference strand. If --norc is specified,
bowtie2 will not attempt to align unpaired reads against the
reverse-complement (Crick) reference strand. In paired-end mode, --nofw
and --norc pertain to the fragments; i.e. specifying --nofw causes
bowtie2 to explore only those paired-end configurations corresponding to
fragments from the reverse-complement (Crick) strand. Default: both
strands enabled.

    --no-1mm-upfront

By default, Bowtie 2 will attempt to find either an exact or a
1-mismatch end-to-end alignment for the read before trying the multiseed
heuristic. Such alignments can be found very quickly, and many short
read alignments have exact or near-exact end-to-end alignments. However,
this can lead to unexpected alignments when the user also sets options
governing the multiseed heuristic, like -L and -N. For instance, if the
user specifies -N 0 and -L equal to the length of the read, the user
will be surprised to find 1-mismatch alignments reported. This option
prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments
before using the multiseed heuristic, which leads to the expected
behavior when combined with options such as -L and -N. This comes at the
expense of speed.

    --end-to-end

In this mode, Bowtie 2 requires that the entire read align from one end
to the other, without any trimming (or "soft clipping") of characters
from either end. The match bonus --ma always equals 0 in this mode, so
all alignment scores are less than or equal to 0, and the greatest
possible alignment score is 0. This is mutually exclusive with --local.
--end-to-end is the default mode.

    --local

In this mode, Bowtie 2 does not require that the entire read align from
one end to the other. Rather, some characters may be omitted ("soft
clipped") from the ends in order to achieve the greatest possible
alignment score. The match bonus --ma is used in this mode, and the best
possible alignment score is equal to the match bonus (--ma) times the
length of the read. Specifying --local and one of the presets (e.g.
--local --very-fast) is equivalent to specifying the local version of
the preset (--very-fast-local). This is mutually exclusive with
--end-to-end. --end-to-end is the default mode.

Scoring options

    --ma <int>

Sets the match bonus. In --local mode <int> is added to the alignment
score for each position where a read character aligns to a reference
character and the characters match. Not used in --end-to-end mode.
Default: 2.

    --mp MX,MN

Sets the maximum (MX) and minimum (MN) mismatch penalties, both
integers. A number less than or equal to MX and greater than or equal to
MN is subtracted from the alignment score for each position where a read
character aligns to a reference character, the characters do not match,
and neither is an N. If --ignore-quals is specified, the number
subtracted quals MX. Otherwise, the number subtracted is
MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) ) where Q is the Phred quality
value. Default: MX = 6, MN = 2.

    --np <int>

Sets penalty for positions where the read, reference, or both, contain
an ambiguous character such as N. Default: 1.

    --rdg <int1>,<int2>

Sets the read gap open (<int1>) and extend (<int2>) penalties. A read
gap of length N gets a penalty of <int1> + N * <int2>. Default: 5, 3.

    --rfg <int1>,<int2>

Sets the reference gap open (<int1>) and extend (<int2>) penalties. A
reference gap of length N gets a penalty of <int1> + N * <int2>.
Default: 5, 3.

    --score-min <func>

Sets a function governing the minimum alignment score needed for an
alignment to be considered "valid" (i.e. good enough to report). This is
a function of read length. For instance, specifying L,0,-0.6 sets the
minimum-score function f to f(x) = 0 + -0.6 * x, where x is the read
length. See also: setting function options. The default in --end-to-end
mode is L,-0.6,-0.6 and the default in --local mode is G,20,8.

Reporting options

    -k <int>

By default, bowtie2 searches for distinct, valid alignments for each
read. When it finds a valid alignment, it continues looking for
alignments that are nearly as good or better. The best alignment found
is reported (randomly selected from among best if tied). Information
about the best alignments is used to estimate mapping quality and to set
SAM optional fields, such as AS:i and XS:i.

When -k is specified, however, bowtie2 behaves differently. Instead, it
searches for at most <int> distinct, valid alignments for each read. The
search terminates when it can't find more distinct valid alignments, or
when it finds <int>, whichever happens first. All alignments found are
reported in descending order by alignment score. The alignment score for
a paired-end alignment equals the sum of the alignment scores of the
individual mates. Each reported read or pair alignment beyond the first
has the SAM 'secondary' bit (which equals 256) set in its FLAGS field.
For reads that have more than <int> distinct, valid alignments, bowtie2
does not guarantee that the <int> alignments reported are the best
possible in terms of alignment score. -k is mutually exclusive with -a.

Note: Bowtie 2 is not designed with large values for -k in mind, and
when aligning reads to long, repetitive genomes large -k can be very,
very slow.

    -a

Like -k but with no upper limit on number of alignments to search for.
-a is mutually exclusive with -k.

Note: Bowtie 2 is not designed with -a mode in mind, and when aligning
reads to long, repetitive genomes this mode can be very, very slow.

Effort options

    -D <int>

Up to <int> consecutive seed extension attempts can "fail" before Bowtie
2 moves on, using the alignments found so far. A seed extension "fails"
if it does not yield a new best or a new second-best alignment. This
limit is automatically adjusted up when -k or -a are specified. Default:
15.

    -R <int>

<int> is the maximum number of times Bowtie 2 will "re-seed" reads with
repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set
of reads (same length, same number of mismatches allowed) at different
offsets and searches for more alignments. A read is considered to have
repetitive seeds if the total number of seed hits divided by the number
of seeds that aligned at least once is greater than 300. Default: 2.

Paired-end options

    -I/--minins <int>

The minimum fragment length for valid paired-end alignments. E.g. if
-I 60 is specified and a paired-end alignment consists of two 20-bp
alignments in the appropriate orientation with a 20-bp gap between them,
that alignment is considered valid (as long as -X is also satisfied). A
19-bp gap would not be valid in that case. If trimming options -3 or -5
are also used, the -I constraint is applied with respect to the
untrimmed mates.

The larger the difference between -I and -X, the slower Bowtie 2 will
run. This is because larger differences between -I and -X require that
Bowtie 2 scan a larger window to determine if a concordant alignment
exists. For typical fragment length ranges (200 to 400 nucleotides),
Bowtie 2 is very efficient.

Default: 0 (essentially imposing no minimum)

    -X/--maxins <int>

The maximum fragment length for valid paired-end alignments. E.g. if
-X 100 is specified and a paired-end alignment consists of two 20-bp
alignments in the proper orientation with a 60-bp gap between them, that
alignment is considered valid (as long as -I is also satisfied). A 61-bp
gap would not be valid in that case. If trimming options -3 or -5 are
also used, the -X constraint is applied with respect to the untrimmed
mates, not the trimmed mates.

The larger the difference between -I and -X, the slower Bowtie 2 will
run. This is because larger differences between -I and -X require that
Bowtie 2 scan a larger window to determine if a concordant alignment
exists. For typical fragment length ranges (200 to 400 nucleotides),
Bowtie 2 is very efficient.

Default: 500.

    --fr/--rf/--ff

The upstream/downstream mate orientations for a valid paired-end
alignment against the forward reference strand. E.g., if --fr is
specified and there is a candidate paired-end alignment where mate 1
appears upstream of the reverse complement of mate 2 and the fragment
length constraints (-I and -X) are met, that alignment is valid. Also,
if mate 2 appears upstream of the reverse complement of mate 1 and all
other constraints are met, that too is valid. --rf likewise requires
that an upstream mate1 be reverse-complemented and a downstream mate2 be
forward-oriented. --ff requires both an upstream mate 1 and a downstream
mate 2 to be forward-oriented. Default: --fr (appropriate for Illumina's
Paired-end Sequencing Assay).

    --no-mixed

By default, when bowtie2 cannot find a concordant or discordant
alignment for a pair, it then tries to find alignments for the
individual mates. This option disables that behavior.

    --no-discordant

By default, bowtie2 looks for discordant alignments if it cannot find
any concordant alignments. A discordant alignment is an alignment where
both mates align uniquely, but that does not satisfy the paired-end
constraints (--fr/--rf/--ff, -I, -X). This option disables that
behavior.

    --dovetail

If the mates "dovetail", that is if one mate alignment extends past the
beginning of the other such that the wrong mate begins upstream,
consider that to be concordant. See also: Mates can overlap, contain or
dovetail each other. Default: mates cannot dovetail in a concordant
alignment.

    --no-contain

If one mate alignment contains the other, consider that to be
non-concordant. See also: Mates can overlap, contain or dovetail each
other. Default: a mate can contain the other in a concordant alignment.

    --no-overlap

If one mate alignment overlaps the other at all, consider that to be
non-concordant. See also: Mates can overlap, contain or dovetail each
other. Default: mates can overlap in a concordant alignment.

BAM options

    --align-paired-reads

Bowtie 2 will, by default, attempt to align unpaired BAM reads. Use this
option to align paired-end reads instead.

    --preserve-tags

Preserve tags from the original BAM record by appending them to the end
of the corresponding Bowtie 2 SAM output.

Output options

    -t/--time

Print the wall-clock time required to load the index files and align the
reads. This is printed to the "standard error" ("stderr") filehandle.
Default: off.

    --un <path>
    --un-gz <path>
    --un-bz2 <path>
    --un-lz4 <path>

Write unpaired reads that fail to align to file at <path>. These reads
correspond to the SAM records with the FLAGS 0x4 bit set and neither the
0x40 nor 0x80 bits set. If --un-gz is specified, output will be gzip
compressed. If --un-bz2 or --un-lz4 is specified, output will be bzip2
or lz4 compressed. Reads written in this way will appear exactly as they
did in the input file, without any modification (same sequence, same
name, same quality string, same quality encoding). Reads will not
necessarily appear in the same order as they did in the input.

    --al <path>
    --al-gz <path>
    --al-bz2 <path>
    --al-lz4 <path>

Write unpaired reads that align at least once to file at <path>. These
reads correspond to the SAM records with the FLAGS 0x4, 0x40, and 0x80
bits unset. If --al-gz is specified, output will be gzip compressed. If
--al-bz2 is specified, output will be bzip2 compressed. Similarly if
--al-lz4 is specified, output will be lz4 compressed. Reads written in
this way will appear exactly as they did in the input file, without any
modification (same sequence, same name, same quality string, same
quality encoding). Reads will not necessarily appear in the same order
as they did in the input.

    --un-conc <path>
    --un-conc-gz <path>
    --un-conc-bz2 <path>
    --un-conc-lz4 <path>

Write paired-end reads that fail to align concordantly to file(s) at
<path>. These reads correspond to the SAM records with the FLAGS 0x4 bit
set and either the 0x40 or 0x80 bit set (depending on whether it's mate
#1 or #2). .1 and .2 strings are added to the filename to distinguish
which file contains mate #1 and mate #2. If a percent symbol, %, is used
in <path>, the percent symbol is replaced with 1 or 2 to make the
per-mate filenames. Otherwise, .1 or .2 are added before the final dot
in <path> to make the per-mate filenames. Reads written in this way will
appear exactly as they did in the input files, without any modification
(same sequence, same name, same quality string, same quality encoding).
Reads will not necessarily appear in the same order as they did in the
inputs.

    --al-conc <path>
    --al-conc-gz <path>
    --al-conc-bz2 <path>
    --al-conc-lz4 <path>

Write paired-end reads that align concordantly at least once to file(s)
at <path>. These reads correspond to the SAM records with the FLAGS 0x4
bit unset and either the 0x40 or 0x80 bit set (depending on whether it's
mate #1 or #2). .1 and .2 strings are added to the filename to
distinguish which file contains mate #1 and mate #2. If a percent
symbol, %, is used in <path>, the percent symbol is replaced with 1 or 2
to make the per-mate filenames. Otherwise, .1 or .2 are added before the
final dot in <path> to make the per-mate filenames. Reads written in
this way will appear exactly as they did in the input files, without any
modification (same sequence, same name, same quality string, same
quality encoding). Reads will not necessarily appear in the same order
as they did in the inputs.

    --quiet

Print nothing besides alignments and serious errors.

    --met-file <path>

Write bowtie2 metrics to file <path>. Having alignment metric can be
useful for debugging certain problems, especially performance issues.
See also: --met. Default: metrics disabled.

    --met-stderr <path>

Write bowtie2 metrics to the "standard error" ("stderr") filehandle.
This is not mutually exclusive with --met-file. Having alignment metric
can be useful for debugging certain problems, especially performance
issues. See also: --met. Default: metrics disabled.

    --met <int>

Write a new bowtie2 metrics record every <int> seconds. Only matters if
either --met-stderr or --met-file are specified. Default: 1.

SAM options

    --no-unal

Suppress SAM records for reads that failed to align.

    --no-hd

Suppress SAM header lines (starting with @).

    --no-sq

Suppress @SQ SAM header lines.

    --rg-id <text>

Set the read group ID to <text>. This causes the SAM @RG header line to
be printed, with <text> as the value associated with the ID: tag. It
also causes the RG:Z: extra field to be attached to each SAM output
record, with value set to <text>.

    --rg <text>

Add <text> (usually of the form TAG:VAL, e.g. SM:Pool1) as a field on
the @RG header line. Note: in order for the @RG line to appear, --rg-id
must also be specified. This is because the ID tag is required by the
SAM Spec. Specify --rg multiple times to set multiple fields. See the
SAM Spec for details about what fields are legal.

    --omit-sec-seq

When printing secondary alignments, Bowtie 2 by default will write out
the SEQ and QUAL strings. Specifying this option causes Bowtie 2 to
print an asterisk in those fields instead.

    --soft-clipped-unmapped-tlen

Consider soft-clipped bases unmapped when calculating TLEN. Only
available in --local mode.

    --sam-no-qname-trunc

Suppress standard behavior of truncating readname at first whitespace at
the expense of generating non-standard SAM

    --xeq

Use '='/'X', instead of 'M', to specify matches/mismatches in SAM record

    --sam-append-comment

Append FASTA/FASTQ comment to SAM record, where a comment is everything
after the first space in the read name.

Performance options

    -o/--offrate <int>

Override the offrate of the index with <int>. If <int> is greater than
the offrate used to build the index, then some row markings are
discarded when the index is read into memory. This reduces the memory
footprint of the aligner but requires more time to calculate text
offsets. <int> must be greater than the value used to build the index.

    -p/--threads NTHREADS

Launch NTHREADS parallel search threads (default: 1). Threads will run
on separate processors/cores and synchronize when parsing reads and
outputting alignments. Searching for alignments is highly parallel, and
speedup is close to linear. Increasing -p increases Bowtie 2's memory
footprint. E.g. when aligning to a human genome index, increasing -p
from 1 to 8 increases the memory footprint by a few hundred megabytes.
This option is only available if bowtie is linked with the pthreads
library (i.e. if BOWTIE_PTHREADS=0 is not specified at build time).

    --reorder

Guarantees that output SAM records are printed in an order corresponding
to the order of the reads in the original input file, even when -p is
set greater than 1. Specifying --reorder and setting -p greater than 1
causes Bowtie 2 to run somewhat slower and use somewhat more memory than
if --reorder were not specified. Has no effect if -p is set to 1, since
output order will naturally correspond to input order in that case.

    --mm

Use memory-mapped I/O to load the index, rather than typical file I/O.
Memory-mapping allows many concurrent bowtie processes on the same
computer to share the same memory image of the index (i.e. you pay the
memory overhead just once). This facilitates memory-efficient
parallelization of bowtie in situations where using -p is not possible
or not preferable.

Other options

    --qc-filter

Filter out reads for which the QSEQ filter field is non-zero. Only has
an effect when read format is --qseq. Default: off.

    --seed <int>

Use <int> as the seed for pseudo-random number generator. Default: 0.

    --non-deterministic

Normally, Bowtie 2 re-initializes its pseudo-random generator for each
read. It seeds the generator with a number derived from (a) the read
name, (b) the nucleotide sequence, (c) the quality sequence, (d) the
value of the --seed option. This means that if two reads are identical
(same name, same nucleotides, same qualities) Bowtie 2 will find and
report the same alignment(s) for both, even if there was ambiguity. When
--non-deterministic is specified, Bowtie 2 re-initializes its
pseudo-random generator for each read using the current time. This means
that Bowtie 2 will not necessarily report the same alignment for two
identical reads. This is counter-intuitive for some users, but might be
more appropriate in situations where the input consists of many
identical reads.

    --version

Print version information and quit.

    -h/--help

Print usage information and quit.

SAM output
----------

Following is a brief description of the SAM format as output by bowtie2.
For more details, see the SAM format specification.

By default, bowtie2 prints a SAM header with @HD, @SQ and @PG lines.
When one or more --rg arguments are specified, bowtie2 will also print
an @RG line that includes all user-specified --rg tokens separated by
tabs.

Each subsequent line describes an alignment or, if the read failed to
align, a read. Each line is a collection of at least 12 fields separated
by tabs; from left to right, the fields are:

1.  Name of read that aligned.

    Note that the SAM specification disallows whitespace in the read
    name. If the read name contains any whitespace characters, Bowtie 2
    will truncate the name at the first whitespace character. This is
    similar to the behavior of other tools. The standard behavior of
    truncating at the first whitespace can be suppressed with
    --sam-no-qname-trunc at the expense of generating non-standard SAM.

2.  Sum of all applicable flags. Flags relevant to Bowtie are:

        1

    The read is one of a pair

        2

    The alignment is one end of a proper paired-end alignment

        4

    The read has no reported alignments

        8

    The read is one of a pair and has no reported alignments

        16

    The alignment is to the reverse reference strand

        32

    The other mate in the paired-end alignment is aligned to the reverse
    reference strand

        64

    The read is mate 1 in a pair

        128

    The read is mate 2 in a pair

    Thus, an unpaired read that aligns to the reverse reference strand
    will have flag 16. A paired-end read that aligns and is the first
    mate in the pair will have flag 83 (= 64 + 16 + 2 + 1).

3.  Name of reference sequence where alignment occurs

4.  1-based offset into the forward reference strand where leftmost
    character of the alignment occurs

5.  Mapping quality

6.  CIGAR string representation of alignment

7.  Name of reference sequence where mate's alignment occurs. Set to =
    if the mate's reference sequence is the same as this alignment's, or
    * if there is no mate.

8.  1-based offset into the forward reference strand where leftmost
    character of the mate's alignment occurs. Offset is 0 if there is no
    mate.

9.  Inferred fragment length. Size is negative if the mate's alignment
    occurs upstream of this alignment. Size is 0 if the mates did not
    align concordantly. However, size is non-0 if the mates aligned
    discordantly to the same chromosome.

10. Read sequence (reverse-complemented if aligned to the reverse
    strand)

11. ASCII-encoded read qualities (reverse-complemented if the read
    aligned to the reverse strand). The encoded quality values are on
    the Phred quality scale and the encoding is ASCII-offset by 33
    (ASCII char !), similarly to a FASTQ file.

12. Optional fields. Fields are tab-separated. bowtie2 outputs zero or
    more of these optional fields for each alignment, depending on the
    type of the alignment:

    AS:i:<N>

Alignment score. Can be negative. Can be greater than 0 in --local mode
(but not in --end-to-end mode). Only present if SAM record is for an
aligned read.

    XS:i:<N>

Alignment score for the best-scoring alignment found other than the
alignment reported. Can be negative. Can be greater than 0 in --local
mode (but not in --end-to-end mode). Only present if the SAM record is
for an aligned read and more than one alignment was found for the read.
Note that, when the read is part of a concordantly-aligned pair, this
score could be greater than AS:i.

    YS:i:<N>

Alignment score for opposite mate in the paired-end alignment. Only
present if the SAM record is for a read that aligned as part of a
paired-end alignment.

    XN:i:<N>

The number of ambiguous bases in the reference covering this alignment.
Only present if SAM record is for an aligned read.

    XM:i:<N>

The number of mismatches in the alignment. Only present if SAM record is
for an aligned read.

    XO:i:<N>

The number of gap opens, for both read and reference gaps, in the
alignment. Only present if SAM record is for an aligned read.

    XG:i:<N>

The number of gap extensions, for both read and reference gaps, in the
alignment. Only present if SAM record is for an aligned read.

    NM:i:<N>

The edit distance; that is, the minimal number of one-nucleotide edits
(substitutions, insertions and deletions) needed to transform the read
string into the reference string. Only present if SAM record is for an
aligned read.

    YF:Z:<S>

String indicating reason why the read was filtered out. See also:
Filtering. Only appears for reads that were filtered out.

    YT:Z:<S>

Value of UU indicates the read was not part of a pair. Value of CP
indicates the read was part of a pair and the pair aligned concordantly.
Value of DP indicates the read was part of a pair and the pair aligned
discordantly. Value of UP indicates the read was part of a pair but the
pair failed to aligned either concordantly or discordantly.

    MD:Z:<S>

A string representation of the mismatched reference bases in the
alignment. See SAM Tags format specification for details. Only present
if SAM record is for an aligned read.

The bowtie2-build indexer
=========================

bowtie2-build builds a Bowtie index from a set of DNA sequences.
bowtie2-build outputs a set of 6 files with suffixes .1.bt2, .2.bt2,
.3.bt2, .4.bt2, .rev.1.bt2, and .rev.2.bt2. In the case of a large index
these suffixes will have a bt2l termination. These files together
constitute the index: they are all that is needed to align reads to that
reference. The original sequence FASTA files are no longer used by
Bowtie 2 once the index is built.

Bowtie 2's .bt2 index format is different from Bowtie 1's .ebwt format,
and they are not compatible with each other.

Use of Karkkainen's blockwise algorithm allows bowtie2-build to trade
off between running time and memory usage. bowtie2-build has three
options governing how it makes this trade: -p/--packed,
--bmax/--bmaxdivn, and --dcv. By default, bowtie2-build will
automatically search for the settings that yield the best running time
without exhausting memory. This behavior can be disabled using the
-a/--noauto option.

The indexer provides options pertaining to the "shape" of the index,
e.g. --offrate governs the fraction of Burrows-Wheeler rows that are
"marked" (i.e., the density of the suffix-array sample; see the original
FM Index paper for details). All of these options are potentially
profitable trade-offs depending on the application. They have been set
to defaults that are reasonable for most cases according to our
experiments. See Performance tuning for details.

bowtie2-build can generate either small or large indexes. The wrapper
will decide which based on the length of the input genome. If the
reference does not exceed 4 billion characters but a large index is
preferred, the user can specify --large-index to force bowtie2-build to
build a large index instead.

The Bowtie 2 index is based on the FM Index of Ferragina and Manzini,
which in turn is based on the Burrows-Wheeler transform. The algorithm
used to build the index is based on the blockwise algorithm of
Karkkainen.

Command Line
------------

Usage:

    bowtie2-build [options]* <reference_in> <bt2_base>

Main arguments

    <reference_in>

A comma-separated list of FASTA files containing the reference sequences
to be aligned to, or, if -c is specified, the sequences themselves.
E.g., <reference_in> might be chr1.fa,chr2.fa,chrX.fa,chrY.fa, or, if -c
is specified, this might be GGTCATCCT,ACGGGTCGT,CCGTTCTATGCGGCTTA.

    <bt2_base>

The basename of the index files to write. By default, bowtie2-build
writes files named NAME.1.bt2, NAME.2.bt2, NAME.3.bt2, NAME.4.bt2,
NAME.rev.1.bt2, and NAME.rev.2.bt2, where NAME is <bt2_base>.

Options

    -f

The reference input files (specified as <reference_in>) are FASTA files
(usually having extension .fa, .mfa, .fna or similar).

    -c

The reference sequences are given on the command line. I.e.
<reference_in> is a comma-separated list of sequences rather than a list
of FASTA files.

    --large-index

Force bowtie2-build to build a large index, even if the reference is
less than ~ 4 billion nucleotides inlong.

    -a/--noauto

Disable the default behavior whereby bowtie2-build automatically selects
values for the --bmax, --dcv and --packed parameters according to
available memory. Instead, user may specify values for those parameters.
If memory is exhausted during indexing, an error message will be
printed; it is up to the user to try new parameters.

    -p/--packed

Use a packed (2-bits-per-nucleotide) representation for DNA strings.
This saves memory but makes indexing 2-3 times slower. Default: off.
This is configured automatically by default; use -a/--noauto to
configure manually.

    --bmax <int>

The maximum number of suffixes allowed in a block. Allowing more
suffixes per block makes indexing faster, but increases peak memory
usage. Setting this option overrides any previous setting for --bmax, or
--bmaxdivn. Default (in terms of the --bmaxdivn parameter) is --bmaxdivn
4 * number of threads. This is configured automatically by default; use
-a/--noauto to configure manually.

    --bmaxdivn <int>

The maximum number of suffixes allowed in a block, expressed as a
fraction of the length of the reference. Setting this option overrides
any previous setting for --bmax, or --bmaxdivn. Default: --bmaxdivn 4 *
number of threads. This is configured automatically by default; use
-a/--noauto to configure manually.

    --dcv <int>

Use <int> as the period for the difference-cover sample. A larger period
yields less memory overhead, but may make suffix sorting slower,
especially if repeats are present. Must be a power of 2 no greater than
4096. Default: 1024. This is configured automatically by default; use
-a/--noauto to configure manually.

    --nodc

Disable use of the difference-cover sample. Suffix sorting becomes
quadratic-time in the worst case (where the worst case is an extremely
repetitive reference). Default: off.

    -r/--noref

Do not build the NAME.3.bt2 and NAME.4.bt2 portions of the index, which
contain a bitpacked version of the reference sequences and are used for
paired-end alignment.

    -3/--justref

Build only the NAME.3.bt2 and NAME.4.bt2 portions of the index, which
contain a bitpacked version of the reference sequences and are used for
paired-end alignment.

    -o/--offrate <int>

To map alignments back to positions on the reference sequences, it's
necessary to annotate ("mark") some or all of the Burrows-Wheeler rows
with their corresponding location on the genome. -o/--offrate governs
how many rows get marked: the indexer will mark every 2^<int> rows.
Marking more rows makes reference-position lookups faster, but requires
more memory to hold the annotations at runtime. The default is 5 (every
32nd row is marked; for human genome, annotations occupy about 340
megabytes).

    -t/--ftabchars <int>

The ftab is the lookup table used to calculate an initial
Burrows-Wheeler range with respect to the first <int> characters of the
query. A larger <int> yields a larger lookup table but faster query
times. The ftab has size 4^(<int>+1) bytes. The default setting is 10
(ftab is 4MB).

    --seed <int>

Use <int> as the seed for pseudo-random number generator.

    --cutoff <int>

Index only the first <int> bases of the reference sequences (cumulative
across sequences) and ignore the rest.

    -q/--quiet

bowtie2-build is verbose by default. With this option bowtie2-build will
print only error messages.

    --threads <int>

By default bowtie2-build is using only one thread. Increasing the number
of threads will speed up the index building considerably in most cases.

    -h/--help

Print usage information and quit.

    --version

Print version information and quit.

The bowtie2-inspect index inspector
===================================

bowtie2-inspect extracts information from a Bowtie index about what kind
of index it is and what reference sequences were used to build it. When
run without any options, the tool will output a FASTA file containing
the sequences of the original references (with all non-A/C/G/T
characters converted to Ns). It can also be used to extract just the
reference sequence names using the -n/--names option or a more verbose
summary using the -s/--summary option.

Command Line
------------

Usage:

    bowtie2-inspect [options]* <bt2_base>

Main arguments

    <bt2_base>

The basename of the index to be inspected. The basename is name of any
of the index files but with the .X.bt2 or .rev.X.bt2 suffix omitted.
bowtie2-inspect first looks in the current directory for the index
files, then in the directory specified in the BOWTIE2_INDEXES
environment variable.

Options

    -a/--across <int>

When printing FASTA output, output a newline character every <int> bases
(default: 60).

    -n/--names

Print reference sequence names, one per line, and quit.

    -s/--summary

Print a summary that includes information about index settings, as well
as the names and lengths of the input sequences. The summary has this
format:

    Colorspace  <0 or 1>
    SA-Sample   1 in <sample>
    FTab-Chars  <chars>
    Sequence-1  <name>  <len>
    Sequence-2  <name>  <len>
    ...
    Sequence-N  <name>  <len>

Fields are separated by tabs. Colorspace is always set to 0 for Bowtie
2.

    -o/--output <filename>

Save output to user-specified filename (default: stdout)

    -v/--verbose

Print verbose output (for debugging).

    --version

Print version information and quit.

    -h/--help

Print usage information and quit.

Getting started with Bowtie 2: Lambda phage example
===================================================

Bowtie 2 comes with some example files to get you started. The example
files are not scientifically significant; we use the Lambda phage
reference genome simply because it's short, and the reads were generated
by a computer program, not a sequencer. However, these files will let
you start running Bowtie 2 and downstream tools right away.

First follow the manual instructions to obtain Bowtie 2. Set the
BT2_HOME environment variable to point to the new Bowtie 2 directory
containing the bowtie2, bowtie2-build and bowtie2-inspect binaries. This
is important, as the BT2_HOME variable is used in the commands below to
refer to that directory.

Indexing a reference genome
---------------------------

To create an index for the Lambda phage reference genome included with
Bowtie 2, create a new temporary directory (it doesn't matter where),
change into that directory, and run:

    $BT2_HOME/bowtie2-build $BT2_HOME/example/reference/lambda_virus.fa lambda_virus

The command should print many lines of output then quit. When the
command completes, the current directory will contain four new files
that all start with lambda_virus and end with .1.bt2, .2.bt2, .3.bt2,
.4.bt2, .rev.1.bt2, and .rev.2.bt2. These files constitute the index -
you're done!

You can use bowtie2-build to create an index for a set of FASTA files
obtained from any source, including sites such as UCSC, NCBI, and
Ensembl. When indexing multiple FASTA files, specify all the files using
commas to separate file names. For more details on how to create an
index with bowtie2-build, see the manual section on index building. You
may also want to bypass this process by obtaining a pre-built index. See
using a pre-built index below for an example.

Aligning example reads
----------------------

Stay in the directory created in the previous step, which now contains
the lambda_virus index files. Next, run:

    $BT2_HOME/bowtie2 -x lambda_virus -U $BT2_HOME/example/reads/reads_1.fq -S eg1.sam

This runs the Bowtie 2 aligner, which aligns a set of unpaired reads to
the Lambda phage reference genome using the index generated in the
previous step. The alignment results in SAM format are written to the
file eg1.sam, and a short alignment summary is written to the console.
(Actually, the summary is written to the "standard error" or "stderr"
filehandle, which is typically printed to the console.)

To see the first few lines of the SAM output, run:

    head eg1.sam

You will see something like this:

    @HD VN:1.0  SO:unsorted
    @SQ SN:gi|9626243|ref|NC_001416.1|  LN:48502
    @PG ID:bowtie2  PN:bowtie2  VN:2.0.1
    r1  0   gi|9626243|ref|NC_001416.1| 18401   42  122M    *   0   0   TGAATGCGAACTCCGGGACGCTCAGTAATGTGACGATAGCTGAAAACTGTACGATAAACNGTACGCTGAGGGCAGAAAAAATCGTCGGGGACATTNTAAAGGCGGCGAGCGCGGCTTTTCCG  +"@6<:27(F&5)9"B):%B+A-%5A?2$HCB0B+0=D<7E/<.03#!.F77@6B==?C"7>;))%;,3-$.A06+<-1/@@?,26">=?*@'0;$:;??G+:#+(A?9+10!8!?()?7C>  AS:i:-5 XN:i:0  XM:i:3  XO:i:0  XG:i:0  NM:i:3  MD:Z:59G13G21G26    YT:Z:UU
    r2  0   gi|9626243|ref|NC_001416.1| 8886    42  275M    *   0   0   NTTNTGATGCGGGCTTGTGGAGTTCAGCCGATCTGACTTATGTCATTACCTATGAAATGTGAGGACGCTATGCCTGTACCAAATCCTACAATGCCGGTGAAAGGTGCCGGGATCACCCTGTGGGTTTATAAGGGGATCGGTGACCCCTACGCGAATCCGCTTTCAGACGTTGACTGGTCGCGTCTGGCAAAAGTTAAAGACCTGACGCCCGGCGAACTGACCGCTGAGNCCTATGACGACAGCTATCTCGATGATGAAGATGCAGACTGGACTGC (#!!'+!$""%+(+)'%)%!+!(&++)''"#"#&#"!'!("%'""("+&%$%*%%#$%#%#!)*'(#")(($&$'&%+&#%*)*#*%*')(%+!%%*"$%"#+)$&&+)&)*+!"*)!*!("&&"*#+"&"'(%)*("'!$*!!%$&&&$!!&&"(*"$&"#&!$%'%"#)$#+%*+)!&*)+(""#!)!%*#"*)*')&")($+*%%)!*)!('(%""+%"$##"#+(('!*(($*'!"*('"+)&%#&$+('**$$&+*&!#%)')'(+(!%+ AS:i:-14    XN:i:0  XM:i:8  XO:i:0  XG:i:0  NM:i:8  MD:Z:0A0C0G0A108C23G9T81T46 YT:Z:UU
    r3  16  gi|9626243|ref|NC_001416.1| 11599   42  338M    *   0   0   GGGCGCGTTACTGGGATGATCGTGAAAAGGCCCGTCTTGCGCTTGAAGCCGCCCGAAAGAAGGCTGAGCAGCAGACTCAAGAGGAGAAAAATGCGCAGCAGCGGAGCGATACCGAAGCGTCACGGCTGAAATATACCGAAGAGGCGCAGAAGGCTNACGAACGGCTGCAGACGCCGCTGCAGAAATATACCGCCCGTCAGGAAGAACTGANCAAGGCACNGAAAGACGGGAAAATCCTGCAGGCGGATTACAACACGCTGATGGCGGCGGCGAAAAAGGATTATGAAGCGACGCTGTAAAAGCCGAAACAGTCCAGCGTGAAGGTGTCTGCGGGCGAT  7F$%6=$:9B@/F'>=?!D?@0(:A*)7/>9C>6#1<6:C(.CC;#.;>;2'$4D:?&B!>689?(0(G7+0=@37F)GG=>?958.D2E04C<E,*AD%G0.%$+A:'H;?8<72:88?E6((CF)6DF#.)=>B>D-="C'B080E'5BH"77':"@70#4%A5=6.2/1>;9"&-H6)=$/0;5E:<8G!@::1?2DC7C*;@*#.1C0.D>H/20,!"C-#,6@%<+<D(AG-).?&#0.00'@)/F8?B!&"170,)>:?<A7#1(A@0E#&A.*DC.E")AH"+.,5,2>5"2?:G,F"D0B8D-6$65D<D!A/38860.*4;4B<*31?6  AS:i:-22    XN:i:0  XM:i:8  XO:i:0  XG:i:0  NM:i:8  MD:Z:80C4C16A52T23G30A8T76A41   YT:Z:UU
    r4  0   gi|9626243|ref|NC_001416.1| 40075   42  184M    *   0   0   GGGCCAATGCGCTTACTGATGCGGAATTACGCCGTAAGGCCGCAGATGAGCTTGTCCATATGACTGCGAGAATTAACNGTGGTGAGGCGATCCCTGAACCAGTAAAACAACTTCCTGTCATGGGCGGTAGACCTCTAAATCGTGCACAGGCTCTGGCGAAGATCGCAGAAATCAAAGCTAAGT(=8B)GD04*G%&4F,1'A>.C&7=F$,+#6!))43C,5/5+)?-/0>/D3=-,2/+.1?@->;)00!'3!7BH$G)HG+ADC'#-9F)7<7"$?&.>0)@5;4,!0-#C!15CF8&HB+B==H>7,/)C5)5*+(F5A%D,EA<(>G9E0>7&/E?4%;#'92)<5+@7:A.(BG@BG86@.G AS:i:-1 XN:i:0  XM:i:1  XO:i:0  XG:i:0  NM:i:1  MD:Z:77C106 YT:Z:UU
    r5  0   gi|9626243|ref|NC_001416.1| 48010   42  138M    *   0   0   GTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGCCCTCGTAATTAAGTGAATTTACAATATCGTCCTGTTCGGAGGGAAGAACGCGGGATGTTCATTCTTCATCACTTTTAATTGATGTATATGCTCTCTT  9''%<D)A03E1-*7=),:F/0!6,D9:H,<9D%:0B(%'E,(8EFG$E89B$27G8F*2+4,-!,0D5()&=(FGG:5;3*@/.0F-G#5#3->('FDFEG?)5.!)"AGADB3?6(@H(:B<>6!>;>6>G,."?%  AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:138    YT:Z:UU
    r6  16  gi|9626243|ref|NC_001416.1| 41607   42  72M2D119M   *   0   0   TCGATTTGCAAATACCGGAACATCTCGGTAACTGCATATTCTGCATTAAAAAATCAACGCAAAAAATCGGACGCCTGCAAAGATGAGGAGGGATTGCAGCGTGTTTTTAATGAGGTCATCACGGGATNCCATGTGCGTGACGGNCATCGGGAAACGCCAAAGGAGATTATGTACCGAGGAAGAATGTCGCT 1H#G;H"$E*E#&"*)2%66?=9/9'=;4)4/>@%+5#@#$4A*!<D=="8#1*A9BA=:(1+#C&.#(3#H=9E)AC*5,AC#E'536*2?)H14?>9'B=7(3H/B:+A:8%1-+#(E%&$$&14"76D?>7(&20H5%*&CF8!G5B+A4F$7(:"'?0$?G+$)B-?2<0<F=D!38BH,%=8&5@+ AS:i:-13    XN:i:0  XM:i:2  XO:i:1  XG:i:2  NM:i:4  MD:Z:72^TT55C15A47  YT:Z:UU
    r7  16  gi|9626243|ref|NC_001416.1| 4692    42  143M    *   0   0   TCAGCCGGACGCGGGCGCTGCAGCCGTACTCGGGGATGACCGGTTACAACGGCATTATCGCCCGTCTGCAACAGGCTGCCAGCGATCCGATGGTGGACAGCATTCTGCTCGATATGGACANGCCCGGCGGGATGGTGGCGGGG -"/@*7A0)>2,AAH@&"%B)*5*23B/,)90.B@%=FE,E063C9?,:26$-0:,.,1849'4.;F>FA;76+5&$<C":$!A*,<B,<)@<'85D%C*:)30@85;?.B$05=@95DCDH<53!8G:F:B7/A.E':434> AS:i:-6 XN:i:0  XM:i:2  XO:i:0  XG:i:0  NM:i:2  MD:Z:98G21C22   YT:Z:UU

The first few lines (beginning with @) are SAM header lines, and the
rest of the lines are SAM alignments, one line per read or mate. See the
Bowtie 2 manual section on SAM output and the SAM specification for
details about how to interpret the SAM file format.

Paired-end example
------------------

To align paired-end reads included with Bowtie 2, stay in the same
directory and run:

    $BT2_HOME/bowtie2 -x lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam

This aligns a set of paired-end reads to the reference genome, with
results written to the file eg2.sam.

Local alignment example
-----------------------

To use local alignment to align some longer reads included with Bowtie
2, stay in the same directory and run:

    $BT2_HOME/bowtie2 --local -x lambda_virus -U $BT2_HOME/example/reads/longreads.fq -S eg3.sam

This aligns the long reads to the reference genome using local
alignment, with results written to the file eg3.sam.

Using SAMtools/BCFtools downstream
----------------------------------

SAMtools is a collection of tools for manipulating and analyzing SAM and
BAM alignment files. BCFtools is a collection of tools for calling
variants and manipulating VCF and BCF files, and it is typically
distributed with SAMtools. Using these tools together allows you to get
from alignments in SAM format to variant calls in VCF format. This
example assumes that samtools and bcftools are installed and that the
directories containing these binaries are in your PATH environment
variable.

Run the paired-end example:

    $BT2_HOME/bowtie2 -x $BT2_HOME/example/index/lambda_virus -1 $BT2_HOME/example/reads/reads_1.fq -2 $BT2_HOME/example/reads/reads_2.fq -S eg2.sam

Use samtools view to convert the SAM file into a BAM file. BAM is the
binary format corresponding to the SAM text format. Run:

    samtools view -bS eg2.sam > eg2.bam

Use samtools sort to convert the BAM file to a sorted BAM file.

    samtools sort eg2.bam -o eg2.sorted.bam

We now have a sorted BAM file called eg2.sorted.bam. Sorted BAM is a
useful format because the alignments are (a) compressed, which is
convenient for long-term storage, and (b) sorted, which is conveneint
for variant discovery. To generate variant calls in VCF format, run:

    bcftools mpileup -f $BT2_HOME/example/reference/lambda_virus.fa eg2.sorted.bam | bcftools view -Ov - > eg2.raw.bcf

Then to view the variants, run:

    bcftools view eg2.raw.bcf

See the official SAMtools guide to Calling SNPs/INDELs with
SAMtools/BCFtools for more details and variations on this process.
