# Copyright 2004-2008 by Sebastian Bassi.
# Copyright 2013-2018 by Markus Piotrowski.
# All rights reserved.
# This file is part of the Biopython distribution and governed by your
# choice of the "Biopython License Agreement" or the "BSD 3-Clause License".
# Please see the LICENSE file that should have been included as part of this
# package.
"""Calculate the melting temperature of nucleotide sequences.

This module contains three different methods to calculate the melting
temperature of oligonucleotides:

1. Tm_Wallace: 'Rule of thumb'
2. Tm_GC: Empirical formulas based on GC content. Salt and mismatch corrections
   can be included.
3. Tm_NN: Calculation based on nearest neighbor thermodynamics. Several tables
   for DNA/DNA, DNA/RNA and RNA/RNA hybridizations are included.
   Correction for mismatches, dangling ends, salt concentration and other
   additives are available.

Tm_staluc is the 'old' NN calculation and is kept for compatibility. It is,
however, recommended to use Tm_NN instead, since Tm_staluc may be depreceated
in the future. Also, Tm_NN has much more options. Using Tm_staluc and Tm_NN
with default parameters gives (essentially) the same results.

General parameters for most Tm methods:
 - seq -- A Biopython sequence object or a string.
 - check -- Checks if the sequence is valid for the given method (default=
   True). In general, whitespaces and non-base characters are removed and
   characters are converted to uppercase. RNA will be backtranscribed.
 - strict -- Do not allow base characters or neighbor duplex keys (e.g.
   'AT/NA') that could not or not unambigiously be evaluated for the respective
   method (default=True). Note that W (= A or T) and S (= C or G) are not
   ambiguous for Tm_Wallace and Tm_GC. If 'False', average values (if
   applicable) will be used.

This module is not able to detect self-complementary and it will not use
alignment tools to align an oligonucleotide sequence to its target sequence.
Thus it can not detect dangling-ends and mismatches by itself (don't even think
about bulbs and loops). These parameters have to be handed over to the
respective method.

Other public methods of this module:
 - make_table     : To create a table with thermodynamic data.
 - salt_correction: To adjust Tm to a given salt concentration by different
   formulas. This method is called from Tm_GC and Tm_NN but may
   also be accessed 'manually'. It returns a correction term, not
   a corrected Tm!
 - chem_correction: To adjust Tm regarding the chemical additives DMSO and
   formaldehyde. The method returns a corrected Tm. Chemical
   correction is not an integral part of the Tm methods and must
   be called additionally.

For example:

    >>> from Bio.SeqUtils import MeltingTemp as mt
    >>> from Bio.Seq import Seq
    >>> mystring = 'CGTTCCAAAGATGTGGGCATGAGCTTAC'
    >>> myseq = Seq(mystring)
    >>> print('%0.2f' % mt.Tm_Wallace(mystring))
    84.00
    >>> print('%0.2f' % mt.Tm_Wallace(myseq))
    84.00
    >>> print('%0.2f' % mt.Tm_GC(myseq))
    58.73
    >>> print('%0.2f' % mt.Tm_NN(myseq))
    60.32

Tm_NN with default values gives same result as 'old' Tm_staluc. However, values
differ for RNA, since Tm_staluc had some errors for RNA calculation. These
errors have been fixed in this version.

New Tm_NN can do slightly more:
Using different thermodynamic tables, e.g. from Breslauer '86 or Sugimoto '96:

    >>> print('%0.2f' % mt.Tm_NN(myseq, nn_table=mt.DNA_NN1))  # Breslauer '86
    72.19
    >>> print('%0.2f' % mt.Tm_NN(myseq, nn_table=mt.DNA_NN2))  # Sugimoto '96
    65.47

Tables for RNA and RNA/DNA hybrids are included:

    >>> print('%0.2f' % mt.Tm_NN(myseq, nn_table=mt.RNA_NN1))  # Freier '86
    73.35
    >>> print('%0.2f' % mt.Tm_NN(myseq, nn_table=mt.R_DNA_NN1))  # Sugimoto '95
    58.45

Several types of salc correction (for Tm_NN and Tm_GC):

    >>> for i in range(1, 8):
    ...     print("Type: %d, Tm: %0.2f" % (i, Tm_NN(myseq, saltcorr=i)))
    ...
    Type: 1, Tm: 54.27
    Type: 2, Tm: 54.02
    Type: 3, Tm: 59.60
    Type: 4, Tm: 60.64
    Type: 5, Tm: 60.32
    Type: 6, Tm: 59.78
    Type: 7, Tm: 59.78

Correction for other monovalent cations (K+, Tris), Mg2+ and dNTPs according
to von Ahsen et al. (2001) or Owczarzy et al. (2008) (for Tm_NN and Tm_GC):

    >>> print('%0.2f' % mt.Tm_NN(myseq, Na=50, Tris=10))
    60.79
    >>> print('%0.2f' % mt.Tm_NN(myseq, Na=50, Tris=10, Mg=1.5))
    67.39
    >>> print('%0.2f' % mt.Tm_NN(myseq, Na=50, Tris=10, Mg=1.5, saltcorr=7))
    66.81
    >>> print('%0.2f' % mt.Tm_NN(myseq, Na=50, Tris=10, Mg=1.5, dNTPs=0.6,
    ...                          saltcorr=7))
    66.04

Dangling ends and mismatches, e.g.::

    Oligo:     CGTTCCaAAGATGTGGGCATGAGCTTAC       CGTTCCaAAGATGTGGGCATGAGCTTAC
               ::::::X:::::::::::::::::::::  or   ::::::X:::::::::::::::::::::
    Template:  GCAAGGcTTCTACACCCGTACTCGAATG      TGCAAGGcTTCTACACCCGTACTCGAATGC

Here:

    >>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC'))
    60.32
    >>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC',
    ...                    c_seq='GCAAGGcTTCTACACCCGTACTCGAATG'))
    55.39
    >>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC', shift=1,
    ...                   c_seq='TGCAAGGcTTCTACACCCGTACTCGAATGC'))
    55.69

The same for RNA:

    >>> print('%0.2f' % mt.Tm_NN('CGUUCCAAAGAUGUGGGCAUGAGCUUAC',
    ...                   c_seq='UGCAAGGcUUCUACACCCGUACUCGAAUGC',
    ...                   shift=1, nn_table=mt.RNA_NN3,
    ...                   de_table=mt.RNA_DE1))
    73.00

Note, that thermodynamic data are not available for all kind of mismatches,
e.g. most double mismatches or terminal mismatches combined with dangling ends:

    >>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC',
    ...                   c_seq='TtCAAGGcTTCTACACCCGTACTCGAATGC',
    ...                   shift=1))
    Traceback (most recent call last):
    ValueError: no thermodynamic data for neighbors '.C/TT' available

Make your own tables, or update/extend existing tables. E.g., add values for
locked nucleotides. Here, 'locked A' (and its complement) should be represented
by '1':

    >>> mytable = mt.make_table(oldtable=mt.DNA_NN3,
    ...                         values={'A1/T1':(-6.608, -17.235),
    ...                         '1A/1T':(-6.893, -15.923)})
    >>> print('%0.2f' % mt.Tm_NN('CGTTCCAAAGATGTGGGCATGAGCTTAC'))
    60.32
    >>> print('%0.2f' % mt.Tm_NN('CGTTCCA1AGATGTGGGCATGAGCTTAC',
    ...                           nn_table=mytable, check=False))
    ... # 'check' must be False, otherwise '1' would be discarded
    62.53

"""


import math
import warnings

from Bio import SeqUtils, Seq
from Bio import BiopythonWarning
from Bio import BiopythonDeprecationWarning


# Thermodynamic lookup tables (dictionaries):
# Enthalpy (dH) and entropy (dS) values for nearest neighbors and initiation
# process. Calculation of duplex initiation is quite different in several
# papers; to allow for a general calculation, all different initiation
# parameters are included in all tables and non-applicable parameters are set
# to zero.
# The key is either an initiation type (e.g., 'init_A/T') or a nearest neighbor
# duplex sequence (e.g., GT/CA, to read 5'GT3'-3'CA5'). The values are tuples
# of dH (kcal/mol), dS (cal/mol K).

# Turn black code style off
# fmt: off

# DNA/DNA
# Breslauer et al. (1986), Proc Natl Acad Sci USA 83: 3746-3750
DNA_NN1 = {
    "init": (0, 0), "init_A/T": (0, 0), "init_G/C": (0, 0),
    "init_oneG/C": (0, -16.8), "init_allA/T": (0, -20.1), "init_5T/A": (0, 0),
    "sym": (0, -1.3),
    "AA/TT": (-9.1, -24.0), "AT/TA": (-8.6, -23.9), "TA/AT": (-6.0, -16.9),
    "CA/GT": (-5.8, -12.9), "GT/CA": (-6.5, -17.3), "CT/GA": (-7.8, -20.8),
    "GA/CT": (-5.6, -13.5), "CG/GC": (-11.9, -27.8), "GC/CG": (-11.1, -26.7),
    "GG/CC": (-11.0, -26.6)}

# Sugimoto et al. (1996), Nuc Acids Res 24 : 4501-4505
DNA_NN2 = {
    "init": (0.6, -9.0), "init_A/T": (0, 0), "init_G/C": (0, 0),
    "init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
    "sym": (0, -1.4),
    "AA/TT": (-8.0, -21.9), "AT/TA": (-5.6, -15.2), "TA/AT": (-6.6, -18.4),
    "CA/GT": (-8.2, -21.0), "GT/CA": (-9.4, -25.5), "CT/GA": (-6.6, -16.4),
    "GA/CT": (-8.8, -23.5), "CG/GC": (-11.8, -29.0), "GC/CG": (-10.5, -26.4),
    "GG/CC": (-10.9, -28.4)}

# Allawi and SantaLucia (1997), Biochemistry 36: 10581-10594
DNA_NN3 = {
    "init": (0, 0), "init_A/T": (2.3, 4.1), "init_G/C": (0.1, -2.8),
    "init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
    "sym": (0, -1.4),
    "AA/TT": (-7.9, -22.2), "AT/TA": (-7.2, -20.4), "TA/AT": (-7.2, -21.3),
    "CA/GT": (-8.5, -22.7), "GT/CA": (-8.4, -22.4), "CT/GA": (-7.8, -21.0),
    "GA/CT": (-8.2, -22.2), "CG/GC": (-10.6, -27.2), "GC/CG": (-9.8, -24.4),
    "GG/CC": (-8.0, -19.9)}

# SantaLucia & Hicks (2004), Annu. Rev. Biophys. Biomol. Struct 33: 415-440
DNA_NN4 = {
    "init": (0.2, -5.7), "init_A/T": (2.2, 6.9), "init_G/C": (0, 0),
    "init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
    "sym": (0, -1.4),
    "AA/TT": (-7.6, -21.3), "AT/TA": (-7.2, -20.4), "TA/AT": (-7.2, -20.4),
    "CA/GT": (-8.5, -22.7), "GT/CA": (-8.4, -22.4), "CT/GA": (-7.8, -21.0),
    "GA/CT": (-8.2, -22.2), "CG/GC": (-10.6, -27.2), "GC/CG": (-9.8, -24.4),
    "GG/CC": (-8.0, -19.0)}

# RNA/RNA
# Freier et al. (1986), Proc Natl Acad Sci USA 83: 9373-9377
RNA_NN1 = {
    "init": (0, -10.8), "init_A/T": (0, 0), "init_G/C": (0, 0),
    "init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
    "sym": (0, -1.4),
    "AA/TT": (-6.6, -18.4), "AT/TA": (-5.7, -15.5), "TA/AT": (-8.1, -22.6),
    "CA/GT": (-10.5, -27.8), "GT/CA": (-10.2, -26.2), "CT/GA": (-7.6, -19.2),
    "GA/CT": (-13.3, -35.5), "CG/GC": (-8.0, -19.4), "GC/CG": (-14.2, -34.9),
    "GG/CC": (-12.2, -29.7)}

# Xia et al (1998), Biochemistry 37: 14719-14735
RNA_NN2 = {
    "init": (3.61, -1.5), "init_A/T": (3.72, 10.5), "init_G/C": (0, 0),
    "init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
    "sym": (0, -1.4),
    "AA/TT": (-6.82, -19.0), "AT/TA": (-9.38, -26.7), "TA/AT": (-7.69, -20.5),
    "CA/GT": (-10.44, -26.9), "GT/CA": (-11.40, -29.5),
    "CT/GA": (-10.48, -27.1), "GA/CT": (-12.44, -32.5),
    "CG/GC": (-10.64, -26.7), "GC/CG": (-14.88, -36.9),
    "GG/CC": (-13.39, -32.7)}

# Chen et al. (2012), Biochemistry 51: 3508-3522
RNA_NN3 = {
    "init": (6.40, 6.99), "init_A/T": (3.85, 11.04), "init_G/C": (0, 0),
    "init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
    "sym": (0, -1.4),
    "AA/TT": (-7.09, -19.8), "AT/TA": (-9.11, -25.8), "TA/AT": (-8.50, -22.9),
    "CA/GT": (-11.03, -28.8), "GT/CA": (-11.98, -31.3),
    "CT/GA": (-10.90, -28.5), "GA/CT": (-13.21, -34.9),
    "CG/GC": (-10.88, -27.4), "GC/CG": (-16.04, -40.6),
    "GG/CC": (-14.18, -35.0), "GT/TG": (-13.83, -46.9),
    "GG/TT": (-17.82, -56.7), "AG/TT": (-3.96, -11.6),
    "TG/AT": (-0.96, -1.8), "TT/AG": (-10.38, -31.8), "TG/GT": (-12.64, -38.9),
    "AT/TG": (-7.39, -21.0), "CG/GT": (-5.56, -13.9), "CT/GG": (-9.44, -24.7),
    "GG/CT": (-7.03, -16.8), "GT/CG": (-11.09, -28.8)}

# RNA/DNA
# Sugimoto et al. (1995), Biochemistry 34: 11211-11216
R_DNA_NN1 = {
    "init": (1.9, -3.9), "init_A/T": (0, 0), "init_G/C": (0, 0),
    "init_oneG/C": (0, 0), "init_allA/T": (0, 0), "init_5T/A": (0, 0),
    "sym": (0, 0),
    "TT/AA": (-11.5, -36.4), "GT/CA": (-7.8, -21.6), "CT/GA": (-7.0, -19.7),
    "AT/TA": (-8.3, -23.9), "TG/AC": (-10.4, -28.4), "GG/CC": (-12.8, -31.9),
    "CG/GC": (-16.3, -47.1), "AG/TC": (-9.1, -23.5), "TC/AG": (-8.6, -22.9),
    "GC/CG": (-8.0, -17.1), "CC/GG": (-9.3, -23.2), "AC/TG": (-5.9, -12.3),
    "TA/AT": (-7.8, -23.2), "GA/CT": (-5.5, -13.5), "CA/GT": (-9.0, -26.1),
    "AA/TT": (-7.8, -21.9)}

# Internal mismatch and inosine table (DNA)
# Allawi & SantaLucia (1997), Biochemistry 36: 10581-10594
# Allawi & SantaLucia (1998), Biochemistry 37: 9435-9444
# Allawi & SantaLucia (1998), Biochemistry 37: 2170-2179
# Allawi & SantaLucia (1998), Nucl Acids Res 26: 2694-2701
# Peyret et al. (1999), Biochemistry 38: 3468-3477
# Watkins & SantaLucia (2005), Nucl Acids Res 33: 6258-6267
DNA_IMM1 = {
    "AG/TT": (1.0, 0.9), "AT/TG": (-2.5, -8.3), "CG/GT": (-4.1, -11.7),
    "CT/GG": (-2.8, -8.0), "GG/CT": (3.3, 10.4), "GG/TT": (5.8, 16.3),
    "GT/CG": (-4.4, -12.3), "GT/TG": (4.1, 9.5), "TG/AT": (-0.1, -1.7),
    "TG/GT": (-1.4, -6.2), "TT/AG": (-1.3, -5.3), "AA/TG": (-0.6, -2.3),
    "AG/TA": (-0.7, -2.3), "CA/GG": (-0.7, -2.3), "CG/GA": (-4.0, -13.2),
    "GA/CG": (-0.6, -1.0), "GG/CA": (0.5, 3.2), "TA/AG": (0.7, 0.7),
    "TG/AA": (3.0, 7.4),
    "AC/TT": (0.7, 0.2), "AT/TC": (-1.2, -6.2), "CC/GT": (-0.8, -4.5),
    "CT/GC": (-1.5, -6.1), "GC/CT": (2.3, 5.4), "GT/CC": (5.2, 13.5),
    "TC/AT": (1.2, 0.7), "TT/AC": (1.0, 0.7),
    "AA/TC": (2.3, 4.6), "AC/TA": (5.3, 14.6), "CA/GC": (1.9, 3.7),
    "CC/GA": (0.6, -0.6), "GA/CC": (5.2, 14.2), "GC/CA": (-0.7, -3.8),
    "TA/AC": (3.4, 8.0), "TC/AA": (7.6, 20.2),
    "AA/TA": (1.2, 1.7), "CA/GA": (-0.9, -4.2), "GA/CA": (-2.9, -9.8),
    "TA/AA": (4.7, 12.9), "AC/TC": (0.0, -4.4), "CC/GC": (-1.5, -7.2),
    "GC/CC": (3.6, 8.9), "TC/AC": (6.1, 16.4), "AG/TG": (-3.1, -9.5),
    "CG/GG": (-4.9, -15.3), "GG/CG": (-6.0, -15.8), "TG/AG": (1.6, 3.6),
    "AT/TT": (-2.7, -10.8), "CT/GT": (-5.0, -15.8), "GT/CT": (-2.2, -8.4),
    "TT/AT": (0.2, -1.5),
    "AI/TC": (-8.9, -25.5), "TI/AC": (-5.9, -17.4), "AC/TI": (-8.8, -25.4),
    "TC/AI": (-4.9, -13.9), "CI/GC": (-5.4, -13.7), "GI/CC": (-6.8, -19.1),
    "CC/GI": (-8.3, -23.8), "GC/CI": (-5.0, -12.6),
    "AI/TA": (-8.3, -25.0), "TI/AA": (-3.4, -11.2), "AA/TI": (-0.7, -2.6),
    "TA/AI": (-1.3, -4.6), "CI/GA": (2.6, 8.9), "GI/CA": (-7.8, -21.1),
    "CA/GI": (-7.0, -20.0), "GA/CI": (-7.6, -20.2),
    "AI/TT": (0.49, -0.7), "TI/AT": (-6.5, -22.0), "AT/TI": (-5.6, -18.7),
    "TT/AI": (-0.8, -4.3), "CI/GT": (-1.0, -2.4), "GI/CT": (-3.5, -10.6),
    "CT/GI": (0.1, -1.0), "GT/CI": (-4.3, -12.1),
    "AI/TG": (-4.9, -15.8), "TI/AG": (-1.9, -8.5), "AG/TI": (0.1, -1.8),
    "TG/AI": (1.0, 1.0), "CI/GG": (7.1, 21.3), "GI/CG": (-1.1, -3.2),
    "CG/GI": (5.8, 16.9), "GG/CI": (-7.6, -22.0),
    "AI/TI": (-3.3, -11.9), "TI/AI": (0.1, -2.3), "CI/GI": (1.3, 3.0),
    "GI/CI": (-0.5, -1.3)}

# Terminal mismatch table (DNA)
# SantaLucia & Peyret (2001) Patent Application WO 01/94611
DNA_TMM1 = {
    "AA/TA": (-3.1, -7.8), "TA/AA": (-2.5, -6.3), "CA/GA": (-4.3, -10.7),
    "GA/CA": (-8.0, -22.5),
    "AC/TC": (-0.1, 0.5), "TC/AC": (-0.7, -1.3), "CC/GC": (-2.1, -5.1),
    "GC/CC": (-3.9, -10.6),
    "AG/TG": (-1.1, -2.1), "TG/AG": (-1.1, -2.7), "CG/GG": (-3.8, -9.5),
    "GG/CG": (-0.7, -19.2),
    "AT/TT": (-2.4, -6.5), "TT/AT": (-3.2, -8.9), "CT/GT": (-6.1, -16.9),
    "GT/CT": (-7.4, -21.2),
    "AA/TC": (-1.6, -4.0), "AC/TA": (-1.8, -3.8), "CA/GC": (-2.6, -5.9),
    "CC/GA": (-2.7, -6.0), "GA/CC": (-5.0, -13.8), "GC/CA": (-3.2, -7.1),
    "TA/AC": (-2.3, -5.9), "TC/AA": (-2.7, -7.0),
    "AC/TT": (-0.9, -1.7), "AT/TC": (-2.3, -6.3), "CC/GT": (-3.2, -8.0),
    "CT/GC": (-3.9, -10.6), "GC/CT": (-4.9, -13.5), "GT/CC": (-3.0, -7.8),
    "TC/AT": (-2.5, -6.3), "TT/AC": (-0.7, -1.2),
    "AA/TG": (-1.9, -4.4), "AG/TA": (-2.5, -5.9), "CA/GG": (-3.9, -9.6),
    "CG/GA": (-6.0, -15.5), "GA/CG": (-4.3, -11.1), "GG/CA": (-4.6, -11.4),
    "TA/AG": (-2.0, -4.7), "TG/AA": (-2.4, -5.8),
    "AG/TT": (-3.2, -8.7), "AT/TG": (-3.5, -9.4), "CG/GT": (-3.8, -9.0),
    "CT/GG": (-6.6, -18.7), "GG/CT": (-5.7, -15.9), "GT/CG": (-5.9, -16.1),
    "TG/AT": (-3.9, -10.5), "TT/AG": (-3.6, -9.8)}

# Dangling ends table (DNA)
# Bommarito et al. (2000), Nucl Acids Res 28: 1929-1934
DNA_DE1 = {
    "AA/.T": (0.2, 2.3), "AC/.G": (-6.3, -17.1), "AG/.C": (-3.7, -10.0),
    "AT/.A": (-2.9, -7.6), "CA/.T": (0.6, 3.3), "CC/.G": (-4.4, -12.6),
    "CG/.C": (-4.0, -11.9), "CT/.A": (-4.1, -13.0), "GA/.T": (-1.1, -1.6),
    "GC/.G": (-5.1, -14.0), "GG/.C": (-3.9, -10.9), "GT/.A": (-4.2, -15.0),
    "TA/.T": (-6.9, -20.0), "TC/.G": (-4.0, -10.9), "TG/.C": (-4.9, -13.8),
    "TT/.A": (-0.2, -0.5),
    ".A/AT": (-0.7, -0.8), ".C/AG": (-2.1, -3.9), ".G/AC": (-5.9, -16.5),
    ".T/AA": (-0.5, -1.1), ".A/CT": (4.4, 14.9), ".C/CG": (-0.2, -0.1),
    ".G/CC": (-2.6, -7.4), ".T/CA": (4.7, 14.2), ".A/GT": (-1.6, -3.6),
    ".C/GG": (-3.9, -11.2), ".G/GC": (-3.2, -10.4), ".T/GA": (-4.1, -13.1),
    ".A/TT": (2.9, 10.4), ".C/TG": (-4.4, -13.1), ".G/TC": (-5.2, -15.0),
    ".T/TA": (-3.8, -12.6)}

# Dangling ends table (RNA)
# Turner & Mathews (2010), Nucl Acids Res 38: D280-D282
RNA_DE1 = {
    ".T/AA": (-4.9, -13.2), ".T/CA": (-0.9, -1.3), ".T/GA": (-5.5, -15.1),
    ".T/TA": (-2.3, -5.5),
    ".G/AC": (-9.0, -23.5), ".G/CC": (-4.1, -10.6), ".G/GC": (-8.6, -22.2),
    ".G/TC": (-7.5, -20.31),
    ".C/AG": (-7.4, -20.3), ".C/CG": (-2.8, -7.7), ".C/GG": (-6.4, -16.4),
    ".C/TG": (-3.6, -9.7),
    ".T/AG": (-4.9, -13.2), ".T/CG": (-0.9, -1.3), ".T/GG": (-5.5, -15.1),
    ".T/TG": (-2.3, -5.5),
    ".A/AT": (-5.7, -16.1), ".A/CT": (-0.7, -1.9), ".A/GT": (-5.8, -16.4),
    ".A/TT": (-2.2, -6.8),
    ".G/AT": (-5.7, -16.1), ".G/CT": (-0.7, -1.9), ".G/GT": (-5.8, -16.4),
    ".G/TT": (-2.2, -6.8),
    "AT/.A": (-0.5, -0.6), "CT/.A": (6.9, 22.6), "GT/.A": (0.6, 2.6),
    "TT/.A": (0.6, 2.6),
    "AG/.C": (-1.6, -4.5), "CG/.C": (0.7, 3.2), "GG/.C": (-4.6, -14.8),
    "TG/.C": (-0.4, -1.3),
    "AC/.G": (-2.4, -6.1), "CC/.G": (3.3, 11.6), "GC/.G": (0.8, 3.2),
    "TC/.G": (-1.4, -4.2),
    "AT/.G": (-0.5, -0.6), "CT/.G": (6.9, 22.6), "GT/.G": (0.6, 2.6),
    "TT/.G": (0.6, 2.6),
    "AA/.T": (1.6, 6.1), "CA/.T": (2.2, 8.1), "GA/.T": (0.7, 3.5),
    "TA/.T": (3.1, 10.6),
    "AG/.T": (1.6, 6.1), "CG/.T": (2.2, 8.1), "GG/.T": (0.7, 3.5),
    "TG/.T": (3.1, 10.6)}

# Turn black code style on
# fmt: on


def make_table(oldtable=None, values=None):
    """Return a table with thermodynamic parameters (as dictionary).

    Arguments:
     - oldtable: An existing dictionary with thermodynamic parameters.
     - values: A dictionary with new or updated values.

    E.g., to replace the initiation parameters in the Sugimoto '96 dataset with
    the initiation parameters from Allawi & SantaLucia '97:

    >>> from Bio.SeqUtils.MeltingTemp import make_table, DNA_NN2
    >>> table = DNA_NN2                               # Sugimoto '96
    >>> table['init_A/T']
    (0, 0)
    >>> newtable = make_table(oldtable=DNA_NN2, values={'init': (0, 0),
    ...                       'init_A/T': (2.3, 4.1),
    ...                       'init_G/C': (0.1, -2.8)})
    >>> print("%0.1f, %0.1f" % newtable['init_A/T'])
    2.3, 4.1

    """
    if oldtable is None:
        table = {
            "init": (0, 0),
            "init_A/T": (0, 0),
            "init_G/C": (0, 0),
            "init_oneG/C": (0, 0),
            "init_allA/T": (0, 0),
            "init_5T/A": (0, 0),
            "sym": (0, 0),
            "AA/TT": (0, 0),
            "AT/TA": (0, 0),
            "TA/AT": (0, 0),
            "CA/GT": (0, 0),
            "GT/CA": (0, 0),
            "CT/GA": (0, 0),
            "GA/CT": (0, 0),
            "CG/GC": (0, 0),
            "GC/CG": (0, 0),
            "GG/CC": (0, 0),
        }
    else:
        table = oldtable.copy()
    if values:
        table.update(values)
    return table


def _check(seq, method):
    """Return a sequence which fullfils the requirements of the given method (PRIVATE).

    All Tm methods in this package require the sequence in uppercase format.
    Most methods make use of the length of the sequence (directly or
    indirectly), which can only be expressed as len(seq) if the sequence does
    not contain whitespaces and other non-base characters. RNA sequences are
    backtranscribed to DNA. This method is PRIVATE.

    Arguments:
     - seq: The sequence as given by the user (passed as string).
     - method: Tm_Wallace, Tm_GC or Tm_NN.

    >>> from Bio.SeqUtils import MeltingTemp as mt
    >>> mt._check('10 ACGTTGCAAG tccatggtac', 'Tm_NN')
    'ACGTTGCAAGTCCATGGTAC'

    """
    seq = "".join(seq.split()).upper()
    seq = str(Seq.Seq(seq).back_transcribe())
    if method == "Tm_Wallace":
        return seq
    if method == "Tm_GC":
        baseset = (
            "A",
            "B",
            "C",
            "D",
            "G",
            "H",
            "I",
            "K",
            "M",
            "N",
            "R",
            "S",
            "T",
            "V",
            "W",
            "X",
            "Y",
        )
    if method == "Tm_NN":
        baseset = ("A", "C", "G", "T", "I")
    seq = "".join([base for base in seq if base in baseset])
    return seq


def salt_correction(Na=0, K=0, Tris=0, Mg=0, dNTPs=0, method=1, seq=None):
    """Calculate a term to correct Tm for salt ions.

    Depending on the Tm calculation, the term will correct Tm or entropy. To
    calculate corrected Tm values, different operations need to be applied:

     - methods 1-4: Tm(new) = Tm(old) + corr
     - method 5: deltaS(new) = deltaS(old) + corr
     - methods 6+7: Tm(new) = 1/(1/Tm(old) + corr)

    Arguments:
     - Na, K, Tris, Mg, dNTPS: Millimolar concentration of respective ion. To
       have a simple 'salt correction', just pass Na. If any of K, Tris, Mg and
       dNTPS is non-zero, a 'sodium-equivalent' concentration is calculated
       according to von Ahsen et al. (2001, Clin Chem 47: 1956-1961):
       [Na_eq] = [Na+] + [K+] + [Tris]/2 + 120*([Mg2+] - [dNTPs])^0.5
       If [dNTPs] >= [Mg2+]: [Na_eq] = [Na+] + [K+] + [Tris]/2
     - method: Which method to be applied. Methods 1-4 correct Tm, method 5
       corrects deltaS, methods 6 and 7 correct 1/Tm. The methods are:

       1. 16.6 x log[Na+]
          (Schildkraut & Lifson (1965), Biopolymers 3: 195-208)
       2. 16.6 x log([Na+]/(1.0 + 0.7*[Na+]))
          (Wetmur (1991), Crit Rev Biochem Mol Biol 126: 227-259)
       3. 12.5 x log(Na+]
          (SantaLucia et al. (1996), Biochemistry 35: 3555-3562
       4. 11.7 x log[Na+]
          (SantaLucia (1998), Proc Natl Acad Sci USA 95: 1460-1465
       5. Correction for deltaS: 0.368 x (N-1) x ln[Na+]
          (SantaLucia (1998), Proc Natl Acad Sci USA 95: 1460-1465)
       6. (4.29(%GC)-3.95)x1e-5 x ln[Na+] + 9.40e-6 x ln[Na+]^2
          (Owczarzy et al. (2004), Biochemistry 43: 3537-3554)
       7. Complex formula with decision tree and 7 empirical constants.
          Mg2+ is corrected for dNTPs binding (if present)
          (Owczarzy et al. (2008), Biochemistry 47: 5336-5353)

    Examples
    --------
    >>> from Bio.SeqUtils import MeltingTemp as mt
    >>> print('%0.2f' % mt.salt_correction(Na=50, method=1))
    -21.60
    >>> print('%0.2f' % mt.salt_correction(Na=50, method=2))
    -21.85
    >>> print('%0.2f' % mt.salt_correction(Na=100, Tris=20, method=2))
    -16.45
    >>> print('%0.2f' % mt.salt_correction(Na=100, Tris=20, Mg=1.5, method=2))
    -10.99

    """
    if method in (5, 6, 7) and not seq:
        raise ValueError(
            "sequence is missing (is needed to calculate GC content or sequence length)."
        )
    if seq:
        seq = str(seq)
    corr = 0
    if not method:
        return corr
    Mon = Na + K + Tris / 2.0  # Note: all these values are millimolar
    mg = Mg * 1e-3  # Lowercase ions (mg, mon, dntps) are molar
    # Na equivalent according to von Ahsen et al. (2001):
    if sum((K, Mg, Tris, dNTPs)) > 0 and not method == 7 and dNTPs < Mg:
        # dNTPs bind Mg2+ strongly. If [dNTPs] is larger or equal than
        # [Mg2+], free Mg2+ is considered not to be relevant.
        Mon += 120 * math.sqrt(Mg - dNTPs)
    mon = Mon * 1e-3
    # Note: math.log = ln(), math.log10 = log()
    if method in range(1, 7) and not mon:
        raise ValueError(
            "Total ion concentration of zero is not allowed in this method."
        )
    if method == 1:
        corr = 16.6 * math.log10(mon)
    if method == 2:
        corr = 16.6 * math.log10((mon) / (1.0 + 0.7 * (mon)))
    if method == 3:
        corr = 12.5 * math.log10(mon)
    if method == 4:
        corr = 11.7 * math.log10(mon)
    if method == 5:
        corr = 0.368 * (len(seq) - 1) * math.log(mon)
    if method == 6:
        corr = (
            (4.29 * SeqUtils.GC(seq) / 100 - 3.95) * 1e-5 * math.log(mon)
        ) + 9.40e-6 * math.log(mon) ** 2
    # Turn black code style off
    # fmt: off
    if method == 7:
        a, b, c, d = 3.92, -0.911, 6.26, 1.42
        e, f, g = -48.2, 52.5, 8.31
        if dNTPs > 0:
            dntps = dNTPs * 1e-3
            ka = 3e4  # Dissociation constant for Mg:dNTP
            # Free Mg2+ calculation:
            mg = (-(ka * dntps - ka * mg + 1.0)
                  + math.sqrt((ka * dntps - ka * mg + 1.0) ** 2
                              + 4.0 * ka * mg)) / (2.0 * ka)
        if Mon > 0:
            R = math.sqrt(mg) / mon
            if R < 0.22:
                corr = (4.29 * SeqUtils.GC(seq) / 100 - 3.95) * \
                    1e-5 * math.log(mon) + 9.40e-6 * math.log(mon) ** 2
                return corr
            elif R < 6.0:
                a = 3.92 * (0.843 - 0.352 * math.sqrt(mon) * math.log(mon))
                d = 1.42 * (1.279 - 4.03e-3 * math.log(mon)
                            - 8.03e-3 * math.log(mon) ** 2)
                g = 8.31 * (0.486 - 0.258 * math.log(mon)
                            + 5.25e-3 * math.log(mon) ** 3)
        corr = (a + b * math.log(mg) + (SeqUtils.GC(seq) / 100)
                * (c + d * math.log(mg)) + (1 / (2.0 * (len(seq) - 1)))
                * (e + f * math.log(mg) + g * math.log(mg) ** 2)) * 1e-5
    # Turn black code style on
    # fmt: on
    if method > 7:
        raise ValueError("Allowed values for parameter 'method' are 1-7.")
    return corr


def chem_correction(
    melting_temp, DMSO=0, fmd=0, DMSOfactor=0.75, fmdfactor=0.65, fmdmethod=1, GC=None
):
    """Correct a given Tm for DMSO and formamide.

    Please note that these corrections are +/- rough approximations.

    Arguments:
     - melting_temp: Melting temperature.
     - DMSO: Percent DMSO.
     - fmd: Formamide concentration in %(fmdmethod=1) or molar (fmdmethod=2).
     - DMSOfactor: How much should Tm decreases per percent DMSO. Default=0.65
       (von Ahsen et al. 2001). Other published values are 0.5, 0.6 and 0.675.
     - fmdfactor: How much should Tm decrease per percent formamide.
       Default=0.65. Several papers report factors between 0.6 and 0.72.
     - fmdmethod:

         1. Tm = Tm - factor(%formamide) (Default)
         2. Tm = Tm + (0.453(f(GC)) - 2.88) x [formamide]

       Here f(GC) is fraction of GC.
       Note (again) that in fmdmethod=1 formamide concentration is given in %,
       while in fmdmethod=2 it is given in molar.
     - GC: GC content in percent.

    Examples:
        >>> from Bio.SeqUtils import MeltingTemp as mt
        >>> mt.chem_correction(70)
        70
        >>> print('%0.2f' % mt.chem_correction(70, DMSO=3))
        67.75
        >>> print('%0.2f' % mt.chem_correction(70, fmd=5))
        66.75
        >>> print('%0.2f' % mt.chem_correction(70, fmdmethod=2, fmd=1.25,
        ...                                    GC=50))
        66.68

    """
    if DMSO:
        melting_temp -= DMSOfactor * DMSO
    if fmd:
        # McConaughy et al. (1969), Biochemistry 8: 3289-3295
        if fmdmethod == 1:
            # Note: Here fmd is given in percent
            melting_temp -= fmdfactor * fmd
        # Blake & Delcourt (1996), Nucl Acids Res 11: 2095-2103
        if fmdmethod == 2:
            if GC is None or GC < 0:
                raise ValueError("'GC' is missing or negative")
            # Note: Here fmd is given in molar
            melting_temp += (0.453 * (GC / 100.0) - 2.88) * fmd
        if fmdmethod not in (1, 2):
            raise ValueError("'fmdmethod' must be 1 or 2")
    return melting_temp


def Tm_Wallace(seq, check=True, strict=True):
    """Calculate and return the Tm using the 'Wallace rule'.

    Tm = 4 degC * (G + C) + 2 degC * (A+T)

    The Wallace rule (Thein & Wallace 1986, in Human genetic diseases: a
    practical approach, 33-50) is often used as rule of thumb for approximate
    Tm calculations for primers of 14 to 20 nt length.

    Non-DNA characters (e.g., E, F, J, !, 1, etc) are ignored by this method.

    Examples:
        >>> from Bio.SeqUtils import MeltingTemp as mt
        >>> mt.Tm_Wallace('ACGTTGCAATGCCGTA')
        48.0
        >>> mt.Tm_Wallace('ACGT TGCA ATGC CGTA')
        48.0
        >>> mt.Tm_Wallace('1ACGT2TGCA3ATGC4CGTA')
        48.0

    """
    seq = str(seq)
    if check:
        seq = _check(seq, "Tm_Wallace")

    melting_temp = 2 * (sum(map(seq.count, ("A", "T", "W")))) + 4 * (
        sum(map(seq.count, ("C", "G", "S")))
    )

    # Intermediate values for ambiguous positions:
    tmp = (
        3 * (sum(map(seq.count, ("K", "M", "N", "R", "Y"))))
        + 10 / 3.0 * (sum(map(seq.count, ("B", "V"))))
        + 8 / 3.0 * (sum(map(seq.count, ("D", "H"))))
    )
    if strict and tmp:
        raise ValueError(
            "ambiguous bases B, D, H, K, M, N, R, V, Y not allowed when strict=True"
        )
    else:
        melting_temp += tmp
    return melting_temp


def Tm_GC(
    seq,
    check=True,
    strict=True,
    valueset=7,
    userset=None,
    Na=50,
    K=0,
    Tris=0,
    Mg=0,
    dNTPs=0,
    saltcorr=0,
    mismatch=True,
):
    """Return the Tm using empirical formulas based on GC content.

    General format: Tm = A + B(%GC) - C/N + salt correction - D(%mismatch)

    A, B, C, D: empirical constants, N: primer length
    D (amount of decrease in Tm per % mismatch) is often 1, but sometimes other
    values have been used (0.6-1.5). Use 'X' to indicate the mismatch position
    in the sequence. Note that this mismatch correction is a rough estimate.

    >>> from Bio.SeqUtils import MeltingTemp as mt
    >>> print("%0.2f" % mt.Tm_GC('CTGCTGATXGCACGAGGTTATGG', valueset=2))
    69.20

    Arguments:
     - valueset: A few often cited variants are included:

        1. Tm = 69.3 + 0.41(%GC) - 650/N
           (Marmur & Doty 1962, J Mol Biol 5: 109-118; Chester & Marshak 1993),
           Anal Biochem 209: 284-290)
        2. Tm = 81.5 + 0.41(%GC) - 675/N - %mismatch
           'QuikChange' formula. Recommended (by the manufacturer) for the
           design of primers for QuikChange mutagenesis.
        3. Tm = 81.5 + 0.41(%GC) - 675/N + 16.6 x log[Na+]
           (Marmur & Doty 1962, J Mol Biol 5: 109-118; Schildkraut & Lifson
           1965, Biopolymers 3: 195-208)
        4. Tm = 81.5 + 0.41(%GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x
           [Na+])) - %mismatch
           (Wetmur 1991, Crit Rev Biochem Mol Biol 126: 227-259). This is the
           standard formula in approximative mode of MELTING 4.3.
        5. Tm = 78 + 0.7(%GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+]))
           - %mismatch
           (Wetmur 1991, Crit Rev Biochem Mol Biol 126: 227-259). For RNA.
        6. Tm = 67 + 0.8(%GC) - 500/N + 16.6 x log([Na+]/(1.0 + 0.7 x [Na+]))
           - %mismatch
           (Wetmur 1991, Crit Rev Biochem Mol Biol 126: 227-259). For RNA/DNA
           hybrids.
        7. Tm = 81.5 + 0.41(%GC) - 600/N + 16.6 x log[Na+]
           Used by Primer3Plus to calculate the product Tm. Default set.
        8. Tm = 77.1 + 0.41(%GC) - 528/N + 11.7 x log[Na+]
           (von Ahsen et al. 2001, Clin Chem 47: 1956-1961). Recommended 'as a
           tradeoff between accuracy and ease of use'.

     - userset: Tuple of four values for A, B, C, and D. Usersets override
       valuesets.
     - Na, K, Tris, Mg, dNTPs: Concentration of the respective ions [mM]. If
       any of K, Tris, Mg and dNTPS is non-zero, a 'sodium-equivalent'
       concentration is calculated and used for salt correction (von Ahsen et
       al., 2001).
     - saltcorr: Type of salt correction (see method salt_correction).
       Default=5. 0 or None means no salt correction.
     - mismatch: If 'True' (default) every 'X' in the sequence is counted as
       mismatch.

    """
    if saltcorr == 5:
        raise ValueError("salt-correction method 5 not applicable to Tm_GC")
    seq = str(seq)
    if check:
        seq = _check(seq, "Tm_GC")
    percent_gc = SeqUtils.GC(seq)
    # Ambiguous bases: add 0.5, 0.67 or 0.33% depending on G+C probability:
    tmp = (
        sum(map(seq.count, ("K", "M", "N", "R", "Y"))) * 50.0 / len(seq)
        + sum(map(seq.count, ("B", "V"))) * 66.67 / len(seq)
        + sum(map(seq.count, ("D", "H"))) * 33.33 / len(seq)
    )
    if strict and tmp:
        raise ValueError(
            "ambiguous bases B, D, H, K, M, N, R, V, Y not allowed when 'strict=True'"
        )
    else:
        percent_gc += tmp
    if userset:
        A, B, C, D = userset
    else:
        if valueset == 1:
            A, B, C, D = (69.3, 0.41, 650, 1)
            saltcorr = 0
        if valueset == 2:
            A, B, C, D = (81.5, 0.41, 675, 1)
            saltcorr = 0
        if valueset == 3:
            A, B, C, D = (81.5, 0.41, 675, 1)
            saltcorr = 2
        if valueset == 4:
            A, B, C, D = (81.5, 0.41, 500, 1)
            saltcorr = 3
        if valueset == 5:
            A, B, C, D = (78.0, 0.7, 500, 1)
            saltcorr = 3
        if valueset == 6:
            A, B, C, D = (67.0, 0.8, 500, 1)
            saltcorr = 3
        if valueset == 7:
            A, B, C, D = (81.5, 0.41, 600, 1)
            saltcorr = 2
        if valueset == 8:
            A, B, C, D = (77.1, 0.41, 528, 1)
            saltcorr = 4
    if valueset > 8:
        raise ValueError("allowed values for parameter 'valueset' are 0-8.")

    melting_temp = A + B * percent_gc - C / (len(seq) * 1.0)
    if saltcorr:
        melting_temp += salt_correction(
            Na=Na, K=K, Tris=Tris, Mg=Mg, dNTPs=dNTPs, seq=seq, method=saltcorr
        )
    if mismatch:
        melting_temp -= D * (seq.count("X") * 100.0 / len(seq))
    return melting_temp


def _key_error(neighbors, strict):
    """Throw an error or a warning if there is no data for the neighbors (PRIVATE)."""
    # We haven't found the key in the tables
    if strict:
        raise ValueError("no thermodynamic data for neighbors %r available" % neighbors)
    else:
        warnings.warn(
            "no themodynamic data for neighbors %r available. "
            "Calculation will be wrong" % neighbors,
            BiopythonWarning,
        )


def Tm_NN(
    seq,
    check=True,
    strict=True,
    c_seq=None,
    shift=0,
    nn_table=None,
    tmm_table=None,
    imm_table=None,
    de_table=None,
    dnac1=25,
    dnac2=25,
    selfcomp=False,
    Na=50,
    K=0,
    Tris=0,
    Mg=0,
    dNTPs=0,
    saltcorr=5,
):
    """Return the Tm using nearest neighbor thermodynamics.

    Arguments:
     - seq: The primer/probe sequence as string or Biopython sequence object.
       For RNA/DNA hybridizations seq must be the RNA sequence.
     - c_seq: Complementary sequence. The sequence of the template/target in
       3'->5' direction. c_seq is necessary for mismatch correction and
       dangling-ends correction. Both corrections will automatically be
       applied if mismatches or dangling ends are present. Default=None.
     - shift: Shift of the primer/probe sequence on the template/target
       sequence, e.g.::

                           shift=0       shift=1        shift= -1
        Primer (seq):      5' ATGC...    5'  ATGC...    5' ATGC...
        Template (c_seq):  3' TACG...    3' CTACG...    3'  ACG...

       The shift parameter is necessary to align seq and c_seq if they have
       different lengths or if they should have dangling ends. Default=0
     - table: Thermodynamic NN values, eight tables are implemented:
       For DNA/DNA hybridizations:

        - DNA_NN1: values from Breslauer et al. (1986)
        - DNA_NN2: values from Sugimoto et al. (1996)
        - DNA_NN3: values from Allawi & SantaLucia (1997) (default)
        - DNA_NN4: values from SantaLucia & Hicks (2004)

       For RNA/RNA hybridizations:

        - RNA_NN1: values from Freier et al. (1986)
        - RNA_NN2: values from Xia et al. (1998)
        - RNA_NN3: valuse from Chen et al. (2012)

       For RNA/DNA hybridizations:

        - R_DNA_NN1: values from Sugimoto et al. (1995)
          Note that ``seq`` must be the RNA sequence.

       Use the module's maketable method to make a new table or to update one
       one of the implemented tables.
     - tmm_table: Thermodynamic values for terminal mismatches.
       Default: DNA_TMM1 (SantaLucia & Peyret, 2001)
     - imm_table: Thermodynamic values for internal mismatches, may include
       insosine mismatches. Default: DNA_IMM1 (Allawi & SantaLucia, 1997-1998;
       Peyret et al., 1999; Watkins & SantaLucia, 2005)
     - de_table: Thermodynamic values for dangling ends:

        - DNA_DE1: for DNA. Values from Bommarito et al. (2000) (default)
        - RNA_DE1: for RNA. Values from Turner & Mathews (2010)

     - dnac1: Concentration of the higher concentrated strand [nM]. Typically
       this will be the primer (for PCR) or the probe. Default=25.
     - dnac2: Concentration of the lower concentrated strand [nM]. In PCR this
       is the template strand which concentration is typically very low and may
       be ignored (dnac2=0). In oligo/oligo hybridization experiments, dnac1
       equals dnac1. Default=25.
       MELTING and Primer3Plus use k = [Oligo(Total)]/4 by default. To mimic
       this behaviour, you have to divide [Oligo(Total)] by 2 and assign this
       concentration to dnac1 and dnac2. E.g., Total oligo concentration of
       50 nM in Primer3Plus means dnac1=25, dnac2=25.
     - selfcomp: Is the sequence self-complementary? Default=False. If 'True'
       the primer is thought binding to itself, thus dnac2 is not considered.
     - Na, K, Tris, Mg, dNTPs: See method 'Tm_GC' for details. Defaults: Na=50,
       K=0, Tris=0, Mg=0, dNTPs=0.
     - saltcorr: See method 'Tm_GC'. Default=5. 0 means no salt correction.

    """
    # Set defaults
    if not nn_table:
        nn_table = DNA_NN3
    if not tmm_table:
        tmm_table = DNA_TMM1
    if not imm_table:
        imm_table = DNA_IMM1
    if not de_table:
        de_table = DNA_DE1

    seq = str(seq)
    if not c_seq:
        # c_seq must be provided by user if dangling ends or mismatches should
        # be taken into account. Otherwise take perfect complement.
        c_seq = Seq.Seq(seq).complement()
    c_seq = str(c_seq)
    if check:
        seq = _check(seq, "Tm_NN")
        c_seq = _check(c_seq, "Tm_NN")
    tmp_seq = seq
    tmp_cseq = c_seq
    delta_h = 0
    delta_s = 0
    d_h = 0  # Names for indexes
    d_s = 1  # 0 and 1

    # Dangling ends?
    if shift or len(seq) != len(c_seq):
        # Align both sequences using the shift parameter
        if shift > 0:
            tmp_seq = "." * shift + seq
        if shift < 0:
            tmp_cseq = "." * abs(shift) + c_seq
        if len(tmp_cseq) > len(tmp_seq):
            tmp_seq += (len(tmp_cseq) - len(tmp_seq)) * "."
        if len(tmp_cseq) < len(tmp_seq):
            tmp_cseq += (len(tmp_seq) - len(tmp_cseq)) * "."
        # Remove 'over-dangling' ends
        while tmp_seq.startswith("..") or tmp_cseq.startswith(".."):
            tmp_seq = tmp_seq[1:]
            tmp_cseq = tmp_cseq[1:]
        while tmp_seq.endswith("..") or tmp_cseq.endswith(".."):
            tmp_seq = tmp_seq[:-1]
            tmp_cseq = tmp_cseq[:-1]
        # Now for the dangling ends
        if tmp_seq.startswith(".") or tmp_cseq.startswith("."):
            left_de = tmp_seq[:2] + "/" + tmp_cseq[:2]
            try:
                delta_h += de_table[left_de][d_h]
                delta_s += de_table[left_de][d_s]
            except KeyError:
                _key_error(left_de, strict)
            tmp_seq = tmp_seq[1:]
            tmp_cseq = tmp_cseq[1:]
        if tmp_seq.endswith(".") or tmp_cseq.endswith("."):
            right_de = tmp_cseq[-2:][::-1] + "/" + tmp_seq[-2:][::-1]
            try:
                delta_h += de_table[right_de][d_h]
                delta_s += de_table[right_de][d_s]
            except KeyError:
                _key_error(right_de, strict)
            tmp_seq = tmp_seq[:-1]
            tmp_cseq = tmp_cseq[:-1]

    # Now for terminal mismatches
    left_tmm = tmp_cseq[:2][::-1] + "/" + tmp_seq[:2][::-1]
    if left_tmm in tmm_table:
        delta_h += tmm_table[left_tmm][d_h]
        delta_s += tmm_table[left_tmm][d_s]
        tmp_seq = tmp_seq[1:]
        tmp_cseq = tmp_cseq[1:]
    right_tmm = tmp_seq[-2:] + "/" + tmp_cseq[-2:]
    if right_tmm in tmm_table:
        delta_h += tmm_table[right_tmm][d_h]
        delta_s += tmm_table[right_tmm][d_s]
        tmp_seq = tmp_seq[:-1]
        tmp_cseq = tmp_cseq[:-1]

    # Now everything 'unusual' at the ends is handled and removed and we can
    # look at the initiation.
    # One or several of the following initiation types may apply:

    # Type: General initiation value
    delta_h += nn_table["init"][d_h]
    delta_s += nn_table["init"][d_s]

    # Type: Duplex with no (allA/T) or at least one (oneG/C) GC pair
    if SeqUtils.GC(seq) == 0:
        delta_h += nn_table["init_allA/T"][d_h]
        delta_s += nn_table["init_allA/T"][d_s]
    else:
        delta_h += nn_table["init_oneG/C"][d_h]
        delta_s += nn_table["init_oneG/C"][d_s]

    # Type: Penalty if 5' end is T
    if seq.startswith("T"):
        delta_h += nn_table["init_5T/A"][d_h]
        delta_s += nn_table["init_5T/A"][d_s]
    if seq.endswith("A"):
        delta_h += nn_table["init_5T/A"][d_h]
        delta_s += nn_table["init_5T/A"][d_s]

    # Type: Different values for G/C or A/T terminal basepairs
    ends = seq[0] + seq[-1]
    AT = ends.count("A") + ends.count("T")
    GC = ends.count("G") + ends.count("C")
    delta_h += nn_table["init_A/T"][d_h] * AT
    delta_s += nn_table["init_A/T"][d_s] * AT
    delta_h += nn_table["init_G/C"][d_h] * GC
    delta_s += nn_table["init_G/C"][d_s] * GC

    # Finally, the 'zipping'
    for basenumber in range(len(tmp_seq) - 1):
        neighbors = (
            tmp_seq[basenumber : basenumber + 2]
            + "/"
            + tmp_cseq[basenumber : basenumber + 2]
        )
        if neighbors in imm_table:
            delta_h += imm_table[neighbors][d_h]
            delta_s += imm_table[neighbors][d_s]
        elif neighbors[::-1] in imm_table:
            delta_h += imm_table[neighbors[::-1]][d_h]
            delta_s += imm_table[neighbors[::-1]][d_s]
        elif neighbors in nn_table:
            delta_h += nn_table[neighbors][d_h]
            delta_s += nn_table[neighbors][d_s]
        elif neighbors[::-1] in nn_table:
            delta_h += nn_table[neighbors[::-1]][d_h]
            delta_s += nn_table[neighbors[::-1]][d_s]
        else:
            # We haven't found the key...
            _key_error(neighbors, strict)

    k = (dnac1 - (dnac2 / 2.0)) * 1e-9
    if selfcomp:
        k = dnac1 * 1e-9
        delta_h += nn_table["sym"][d_h]
        delta_s += nn_table["sym"][d_s]
    R = 1.987  # universal gas constant in Cal/degrees C*Mol
    if saltcorr:
        corr = salt_correction(
            Na=Na, K=K, Tris=Tris, Mg=Mg, dNTPs=dNTPs, method=saltcorr, seq=seq
        )
    if saltcorr == 5:
        delta_s += corr
    melting_temp = (1000 * delta_h) / (delta_s + (R * (math.log(k)))) - 273.15
    if saltcorr in (1, 2, 3, 4):
        melting_temp += corr
    if saltcorr in (6, 7):
        # Tm = 1/(1/Tm + corr)
        melting_temp = 1 / (1 / (melting_temp + 273.15) + corr) - 273.15

    return melting_temp


def Tm_staluc(s, dnac=50, saltc=50, rna=0):
    """Return DNA/DNA Tm using nearest neighbor thermodynamics (OBSOLETE).

    This method may be depreceated in the future. Use Tm_NN instead. Tm_NN
    with default values gives the same result as Tm_staluc.

    s is the sequence as string or Seq object
    dnac is DNA concentration [nM]
    saltc is salt concentration [mM].
    rna=0 is for DNA/DNA (default), use 1 for RNA/RNA hybridisation.

    For DNA/DNA, see Allawi & SantaLucia (1997), Biochemistry 36: 10581-10594
    For RNA/RNA, see Xia et al (1998), Biochemistry 37: 14719-14735

    Examples
    --------
    >>> print("%0.2f" % Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA'))
    59.87
    >>> print("%0.2f" % Tm_staluc('CAGTCAGTACGTACGTGTACTGCCGTA', rna=True))
    77.90

    You can also use a Seq object instead of a string,

    >>> from Bio.Seq import Seq
    >>> s = Seq('CAGTCAGTACGTACGTGTACTGCCGTA')
    >>> print("%0.2f" % Tm_staluc(s))
    59.87
    >>> print("%0.2f" % Tm_staluc(s, rna=True))
    77.90

    """
    # Original method was by Sebastian Bassi <sbassi@genesdigitales.com>. It is
    # now superseded by Tm_NN.

    warnings.warn(
        "Tm_staluc is deprecated; please use Tm_NN instead.",
        BiopythonDeprecationWarning,
    )
    if not rna:
        return Tm_NN(s, dnac1=dnac / 2.0, dnac2=dnac / 2.0, Na=saltc)
    elif rna == 1:
        return Tm_NN(s, dnac1=dnac / 2.0, dnac2=dnac / 2.0, Na=saltc, nn_table=RNA_NN2)
    else:
        raise ValueError(f"rna={rna} not supported")


if __name__ == "__main__":
    from Bio._utils import run_doctest

    run_doctest()
