Report for Auto_user_IONAS-289-DrSpilian_160524_ChIP_BSC1-4_387
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 9,598.36 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,846.59 |
| Total Number of Reads | 74,230,401 |
| Mean Length [bp] | 129 |
| Longest Read [bp] | 371 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 6,169.99 | 4,995.62 |
| Mean Length [bp] | 114 | 96 |
| Longest Alignment [bp] | 313 | 300 |
| Mean Coverage Depth | 2.26× | 1.83× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_05_24_12_18_59_user_IONAS-289-DrSpilian_160524_ChIP_BSC1-4 |
|---|---|
| Run Date | 2016-05-24 09:20:32+00:00 |
| Run Flows | 520 |
| Project | DrSpilianakis_ChIPseq |
| Sample | BSC4-I |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | DrSpilianakis-4ChIPseq_BSC1-D-bc1_BSC2-S-bc2_BSC3-G-bc3_BSC4-I-bc4 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-289-DrSpilian_160524_ChIP_BSC1-4_387 |
| Analysis Date | 2016-05-24 |
| runID | INWD6 |
Software Version
| Torrent_Suite | 5.0.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.3 |
| ion-dbreports | 5.0.33-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.16-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |