Report for Auto_user_IONAS-268-GSR9_GSkP4-5_GKLex1-4_160129_364
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 5,644.73 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 4,098.68 |
| Total Number of Reads | 70,975,203 |
| Mean Length [bp] | 79 |
| Longest Read [bp] | 387 |
 |  |
Reference Genome Information
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 0.00 | 0.00 |
| Mean Length [bp] | 0 | 0 |
| Longest Alignment [bp] | 0 | 0 |
Report Information
Analysis Info
| Run Name | R_2016_01_29_13_01_36_user_IONAS-268-GSR9_GSkP4-5_GKLex1-4_160129 |
|---|---|
| Run Date | 2016-01-29 11:03:05+00:00 |
| Run Flows | 520 |
| Project | DrStathopoulos_RNAseq,LexoGen_QuantSeq,DrMatis_DNA |
| Sample | GSR9-mTECsBalbc |
| Library | N/A |
| Reference | |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | Test_Lexogen GKLex1_438-2-Sal GKLex2_438-3-Sal GKLex3_438-19-Hum GKLex4_438-23-Hum DrStath GSR9_mTECs-Balbc DrSkretas GSkP4_Ab42-Lib-Ilias GSkP5_SOD-Lib-Stefania |
| Barcode Set | IonXpressRNA |
| Analysis Name | Auto_user_IONAS-268-GSR9_GSkP4-5_GKLex1-4_160129_364 |
| Analysis Date | 2016-01-29 |
| runID | VAQJ1 |
Software Version
| Torrent_Suite | 5.0.2 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.7-1 |
| ion-chefupdates | 5.0.1 |
| ion-dbreports | 5.0.19-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.12-1 |
| ion-plugins | 5.0.17-1 |
| ion-protonupdates | 5.0.2 |
| ion-torrentr | 5.0.0-1 |