The fasta header of each read contains the following information:
> readID referenceID CIGARstring MappingQuality
An example is:
>5VQM1:01345:11675 B10_MAC.ab1 2S5M9I203M 33

readID:
the ID given by the sequencer

referenceID:
the ID of the reference sequence the alignment is performed

CIGARstring:
A CIGAR string is comprised of a series of operation lengths plus the operations. The conventional CIGAR format allows
for three types of operations: M for match or mismatch, I for insertion and D for deletion. The extended CIGAR format
further allows four more operations, as is shown in the following table, to describe clipping, padding and splicing:
op Description
M Alignment match (can be a sequence match or mismatch)
I Insertion to the reference
D Deletion from the reference
N Skipped region from the reference
S Soft clip on the read (clipped sequence present in <seq>)
P Padding (silent deletion from the padded reference sequence)
Examples:
Coor    12345678901234 5678901234567890123456789012345
ref     AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT
+r001/1       TTAGATAAAGGATA*CTG
              8M      2I4M  1D3M
+r002        aaaAGATAA*GGATA
             3S 6M    1P1I4M

MappingQuality:
Given 1000 read alignments with mapping quality being 30, one of them will be wrong in average.
Given 100 read alignments with mapping quality being 20, one of them will be wrong in average.
Given 10 read alignments with mapping quality being 10, one of them will be wrong in average.

cat /tmp/foo  | awk  -f sam2aligned-fasta1.awk > r375-all.fa
cat /tmp/foo  | awk -v th=10 -f sam2aligned-fasta1.awk > r375-MQ10.fa
#Passed 210402 mappings  of 262547  80.1388 %
cat /tmp/foo  | awk -v th=20 -f sam2aligned-fasta1.awk > r375-MQ20.fa
#Passed 182334 mappings  of 262547  69.4481 %
cat /tmp/foo  | awk -v th=30 -f sam2aligned-fasta1.awk > r375-MQ30.fa
#Passed 108958 mappings  of 262547  41.5004 %

cat /tmp/foo | awk -v th=30 -f /data/results/tools/align/get-sam-refid-stats1.awk |sort -rn -k3,3
MQ cutoff30
Passed 108958 mappings  of 262547  41.5004 %
longi 26041 23.9
B10_MAC.ab1 25187 23.1162
annu 25051 22.9914
F10_PSEUDO.ab1 8821 8.09578
richi 7512 6.8944
pulcri 5182 4.75596
marti 4332 3.97584
caspius 2920 2.67993
albo 2644 2.42662
vexans 791 0.725968
pipiblack 238 0.218433
detri 200 0.183557
pipiwhite 39 0.0357936

cat /tmp/foo | awk -v th=20 -f /data/results/tools/align/get-sam-refid-stats1.awk |sort -rn -k3,3
MQ cutoff20
Passed 182334 mappings  of 262547  69.4481 %
B10_MAC.ab1 59639 32.7087
longi 30368 16.6551
annu 28120 15.4222
F10_PSEUDO.ab1 16572 9.08882
richi 15766 8.64677
pulcri 9450 5.1828
marti 8082 4.43252
caspius 5327 2.92156
albo 5094 2.79377
vexans 2913 1.59762
pipiblack 520 0.285191
detri 383 0.210054
pipiwhite 100 0.0548444

cat /tmp/foo | awk -v th=10 -f /data/results/tools/align/get-sam-refid-stats1.awk |sort -rn -k3,3
MQ cutoff10
Passed 210402 mappings  of 262547  80.1388 %
B10_MAC.ab1 68556 32.5833
annu 31713 15.0726
longi 31366 14.9077
F10_PSEUDO.ab1 21087 10.0222
richi 17530 8.33167
pulcri 11053 5.25328
marti 10168 4.83265
caspius 6156 2.92583
albo 6081 2.89018
vexans 4273 2.03087
detri 1227 0.583169
pipiblack 1005 0.477657
pipiwhite 187 0.0888775

# convert to bam
samtools view -Sb /tmp/foo -t ~/bak/doc/karakasiliotis/metagenomics/IK28species.fa.fai  > r375.bam