Report for Auto_user_IONAS-342-DrKarakas_170330_YK3R1-13_444
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 5,168.10 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 4,162.21 |
| Total Number of Reads | 35,349,973 |
| Mean Length [bp] | 146 |
| Longest Read [bp] | 388 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 1,534.84 | 757.89 |
| Mean Length [bp] | 128 | 96 |
| Longest Alignment [bp] | 337 | 313 |
| Mean Coverage Depth | 0.56× | 0.28× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2017_03_31_13_20_56_user_IONAS-342-DrKarakas_170330_YK3R1-13 |
|---|---|
| Run Date | 2017-03-31 10:23:10+00:00 |
| Run Flows | 520 |
| Project | LexoGen_QuantSeq,DrKarakasiliotis_3RNAseq |
| Sample | YK3R11-Cplus-1plus |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | YKarakasiliotis_13RNAs_YK3R1-13_YK3R1-11-Mus_YK3R12-13-Homo |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-342-DrKarakas_170330_YK3R1-13_444 |
| Analysis Date | 2017-03-31 |
| runID | X1ZEG |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |