time /home/reczko/Elixir/metagenomics/minimap2/minimap2-2.17_x64-linux/minimap2 -t 12 -a -d nt-minimap2-index /data/results/reference/ncbi/nt/nt.gz /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq | samtools view -Sb - > SPD3.bam time /home/reczko/Elixir/metagenomics/minimap2/minimap2-2.17_x64-linux/minimap2 -t 12 -a nt-minimap2-index /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq > SPD3.sam cat ~/Elixir/metagenomics/SPlab/run440/nt/head Mock_Plant_Community.sam | samtools view -Sb - |samtools flagstat - [M::main::16.849*0.98] loaded/built the index for 924743 target sequence(s) [M::mm_mapopt_update::19.690*0.99] mid_occ = 603 [M::mm_idx_stat] kmer size: 15; skip: 10; is_hpc: 0; #seq: 924743 [M::mm_idx_stat::21.658*0.99] distinct minimizers: 128798079 (32.95% are singletons); average occurrences: 5.835; average spacing: 5.340 [M::worker_pipeline::41.521*5.63] mapped 3368826 sequences [M::worker_pipeline::54.707*7.26] mapped 3493416 sequences [M::worker_pipeline::56.378*7.24] mapped 1298490 sequences [M::main] Version: 2.17-r941 [M::main] CMD: /home/reczko/Elixir/metagenomics/minimap2/minimap2-2.17_x64-linux/minimap2 -t 12 -a nt-minimap2-index /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq [M::main] Real time: 57.194 sec; CPU: 408.776 sec; Peak RSS: 14.258 GB head SPD3.sam @SQ SN:X17276.1 LN:556 @SQ SN:X51700.1 LN:437 @SQ SN:X68321.1 LN:1512 cat SPD3.sam | samtools view -Sb - > SPD3.bam samtools flagstat SPD3.bam 8408135 + 0 in total (QC-passed reads + QC-failed reads) 0 + 0 duplicates 318515 + 0 mapped (3.79%:-nan%) 0 + 0 paired in sequencing 0 + 0 read1 0 + 0 read2 0 + 0 properly paired (-nan%:-nan%) 0 + 0 with itself and mate mapped 0 + 0 singletons (-nan%:-nan%) 0 + 0 with mate mapped to a different chr 0 + 0 with mate mapped to a different chr (mapQ>=5) nt of July2019: -rw-r--r-- 1 reczko users 9753651929 Feb 25 20:59 nt-minimap2-index nt of Feb2020: -rw-r--r-- 1 reczko users 9753523676 Feb 26 11:04 nt-minimap2-index time /home/reczko/Elixir/metagenomics/minimap2/minimap2-2.17_x64-linux/minimap2 -t 12 -a -d nt-minimap2-index ~/Elixir/metagenomics/nt/nt.gz /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq > SPD3b.sam cat SPD3b.sam | samtools view -Sb - > SPD3b.bam samtools flagstat SPD3b.bam time /home/reczko/Elixir/metagenomics/minimap2/minimap2-2.17_x64-linux/minimap2 -N 1 -I 15G -t 14 -a nt-minimap2-index /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq > SPD3d.sam time /home/reczko/Elixir/metagenomics/minimap2/minimap2-2.17_x64-linux/minimap2 -t 12 --split-prefix -a nt-minimap2-index /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq > SPD3c.sam ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i SPD3c.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3c.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db # get SAM header reczko@fix:~/Elixir/metagenomics/nt$ zcat nt.gz | bgzip -c > nt.bgz samtools faidx nt.bgz cat nt.bgz.fai | awk -f fai2samheader.awk > nt.head cat head SPD3b.sam > foo.sam ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i foo.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3b.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db 10% ~220GB res 20% ~340GB 18:05, delta 120GB wc SPD3b.sam 548317655 6770126864 179962146625 SPD3b.sam (/ 548317655 5.0) 109663531 # split in 5 parts cd SPD3b split -l 109663531 ../SPD3b.sam cat ~/Elixir/metagenomics/nt/nt.head xaa > xaa.sam time ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i xaa.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3b1.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db 10% 38g cat ~/Elixir/metagenomics/nt/nt.head xab > xab.sam time ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i xab.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3b2.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db cat ~/Elixir/metagenomics/nt/nt.head xac > xac.sam time ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i xac.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3b3.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db cat ~/Elixir/metagenomics/nt/nt.head xad > xad.sam time ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i xad.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3b4.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db cat ~/Elixir/metagenomics/nt/nt.head xae > xae.sam time ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i xae.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3b5.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i SPD3.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db Version MEGAN Community Edition (version 6.18.5, built 14 Feb 2020) Copyright (C) 2019 Daniel H. Huson. This program comes with ABSOLUTELY NO WARRANTY. Loading ncbi.map: 2,175,506 Loading ncbi.tre: 2,175,510 Current SAM file: SPD3.sam Reads file: /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq Output file: SPD3.rma Classifications: Taxonomy Generating RMA6 file Parsing matches Annotating RMA6 file using FAST mode (accession database and first accession per line) Parsing file SPD3.sam Parsing file: SPD3.sam 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% (594.4s) Total reads: 8,160,732 Alignments: 318,515 100% (0.0s) Binning reads: Initializing... Initializing binning... Using 'Naive LCA' algorithm for binning: Taxonomy Binning reads... Binning reads: Analyzing alignments Total reads: 8,160,732 With hits: 71,112 Alignments: 318,515 Assig. Taxonomy: 71,109 MinSupport set to: 4080 Binning reads: Applying min-support & disabled filter to Taxonomy... Min-supp. changes: 1,248 Binning reads: Writing classification tables Numb. Tax. classes: 39 Binning reads: Syncing Class. Taxonomy: 39 100% (292.1s) Total time: 896s Peak memory: 12.7 of 104.9G time /home/reczko/Elixir/metagenomics/minimap2/minimap2-2.17_x64-linux/minimap2 -N 1 -I 15G -t 14 -a nt-minimap2-index /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq > SPD3d.sam real 51m3.804s user 356m1.064s sys 16m52.794s ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i SPD3d.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3d.rma -mdb ~/Elixir/metagenomics/megan/nt/megan-nucl-Oct2019.db (# wrong mdb (for proteins): ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma -i SPD3.sam -r /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq -o SPD3.rma -mdb ~/Elixir/metagenomics/megan/megan6/megan-map-Oct2019.db Version MEGAN Community Edition (version 6.18.5, built 14 Feb 2020) Copyright (C) 2019 Daniel H. Huson. This program comes with ABSOLUTELY NO WARRANTY. Functional classifications to use: EGGNOG, INTERPRO2GO, SEED Loading ncbi.map: 2,175,506 Loading ncbi.tre: 2,175,510 Loading eggnog.map: 30,875 Loading eggnog.tre: 30,986 Loading interpro2go.map: 13,501 Loading interpro2go.tre: 29,204 Loading seed.map: 13,662 Loading seed.tre: 21,085 Current SAM file: SPD3.sam Reads file: /data/images/proton2/run431/R_2019_08_07_16_07_46_user_IONAS-431-GKlab-MS_SPlab_190807_GK3R288-302_SP3R1-4.SPD3_fragDNA1.IonXpress_031.fastq Output file: SPD4.rma Classifications: Taxonomy, SEED, EGGNOG, INTERPRO2GO Generating RMA6 file Parsing matches Annotating RMA6 file using FAST mode (accession database and first accession per line) Parsing file SPD3.sam Parsing file: SPD3.sam 10% 20% 30% 40% 50% 60% 70% 80% 90% 100% (708.8s) Total reads: 8,160,732 Alignments: 318,515 100% (0.0s) Binning reads: Initializing... Initializing binning... Using 'Naive LCA' algorithm for binning: Taxonomy Using Best-Hit algorithm for binning: SEED Using Best-Hit algorithm for binning: EGGNOG Using Best-Hit algorithm for binning: INTERPRO2GO Binning reads... Binning reads: Analyzing alignments Total reads: 8,160,732 With hits: 71,112 Alignments: 318,515 Assig. Taxonomy: 0 Assig. SEED: 0 Assig. EGGNOG: 0 Assig. INTERPRO2GO: 0 MinSupport set to: 4080 Binning reads: Applying min-support & disabled filter to Taxonomy... Min-supp. changes: 0 Binning reads: Writing classification tables Numb. Tax. classes: 2 Numb. SEED classes: 2 Numb. EGG. classes: 2 Numb. INT. classes: 2 Binning reads: Syncing Class. Taxonomy: 2 Class. SEED: 2 Class. EGGNOG: 2 Class. INTERPRO2GO: 2 100% (560.6s) Total time: 1280s Peak memory: 14.5 of 104.9G ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma SYNOPSIS SAM2RMA6 [options] DESCRIPTION Computes a MEGAN RMA (.rma) file from a SAM (.sam) file that was created by DIAMOND or MALT OPTIONS Input -i, --in [string(s)] Input SAM file[s] generated by DIAMOND or MALT (gzipped ok). Mandatory option. -r, --reads [string(s)] Reads file(s) (fasta or fastq, gzipped ok). . -mdf, --metaDataFile [string(s)] Files containing metadata to be included in RMA6 files. . Output -o, --out [string(s)] Output file(s), one for each input file, or a directory. Mandatory option. -c, --useCompression Compress reads and matches in RMA file (smaller files, longer to generate. Default value: true. Reads -p, --paired Reads are paired. Default value: false. -ps, --pairedSuffixLength [number] Length of name suffix used to distinguish between name of read and its mate. Default value: 0. Parameters -lg, --longReads Parse and analyse as long reads. Default value: false. -m, --maxMatchesPerRead [number] Max matches per read. Default value: 100. -class, --classify Run classification algorithm. Default value: true. -ms, --minScore [number] Min score. Default value: 50.0. -me, --maxExpected [number] Max expected. Default value: 0.01. -top, --topPercent [number] Top percent. Default value: 10.0. -supp, --minSupportPercent [number] Min support as percent of assigned reads (0==off). Default value: 0.05. -sup, --minSupport [number] Min support. Default value: 0. -mrc, --minPercentReadCover [number] Min percent of read length to be covered by alignments. Default value: 0.0. -mrefc, --minPercentReferenceCover [number] Min percent of reference length to be covered by alignments. Default value: 0.0. -alg, --lcaAlgorithm [string] Set the LCA algorithm to use for taxonomic assignment. Default value: naive. Legal values: naive, weighted, longReads -lcp, --lcaCoveragePercent [number] Set the percent for the LCA to cover. Default value: 100.0. -ram, --readAssignmentMode [string] Set the read assignment mode. Default value: readCount. Legal values: readCount, readLength, alignedBases, readMagnitude -cf, --conFile [string] File of contaminant taxa (one Id or name per line). Classification support: Classification support: -mdb, --mapDB [string] MEGAN mapping db (file megan-map.db). Deprecated classification support options: -tn, --parseTaxonNames Parse taxon names. Default value: true. -a2t, --acc2taxa [string] Accession-to-Taxonomy mapping file. -s2t, --syn2taxa [string] Synonyms-to-Taxonomy mapping file. -a2eggnog, --acc2eggnog [string] Accession-to-EGGNOG mapping file. -s2eggnog, --syn2eggnog [string] Synonyms-to-EGGNOG mapping file. -t4eggnog, --tags4eggnog [string] Tags for EGGNOG id parsing (must set to activate id parsing). -a2interpro2go, --acc2interpro2go [string] Accession-to-INTERPRO2GO mapping file. -s2interpro2go, --syn2interpro2go [string] Synonyms-to-INTERPRO2GO mapping file. -t4interpro2go, --tags4interpro2go [string] Tags for INTERPRO2GO id parsing (must set to activate id parsing). -a2kegg, --acc2kegg [string] Accession-to-KEGG mapping file. -s2kegg, --syn2kegg [string] Synonyms-to-KEGG mapping file. -t4kegg, --tags4kegg [string] Tags for KEGG id parsing (must set to activate id parsing). -a2seed, --acc2seed [string] Accession-to-SEED mapping file. -s2seed, --syn2seed [string] Synonyms-to-SEED mapping file. -t4seed, --tags4seed [string] Tags for SEED id parsing (must set to activate id parsing). -a2vfdb, --acc2vfdb [string] Accession-to-VFDB mapping file. -s2vfdb, --syn2vfdb [string] Synonyms-to-VFDB mapping file. -t4vfdb, --tags4vfdb [string] Tags for VFDB id parsing (must set to activate id parsing). Other: -fwa, --firstWordIsAccession First word in reference header is accession number (set to 'true' for NCBI-nr downloaded Sep 2016 or later). Default value: true. -atags, --accessionTags [string(s)] List of accession tags. Default value(s): gb| ref|.. -v, --verbose Echo commandline options and be verbose. Default value: false. -h, --help Show program usage and quit. AUTHOR(s) Daniel H. Huson. VERSION MEGAN Community Edition (version 6.18.5, built 14 Feb 2020). Copyright (C) 2019 Daniel H. Huson. This program comes with ABSOLUTELY NO WARRANTY.. #1st nt alignment: DIAMOND: QHOT2:00025:07130 [length=184, matches=4] Solanum lycopersicum; score=224.0 >CT485992.1 Length >= 53700 Score = 224 Identities = 0/185 (0%), Gaps = 1/185 (1%) Strand = Plus / Plus Query: 1 ACAATAAGCATATTATCAACATAAAGCAACAAAATAACAAAGTCATCATCAGAGAATTTCTGCACAAAAACACAATGGTCAGACGAAGTCTTCTT-AAATCCTGTTGTTTCATAACAAAA 119 Sbjct: 53516 ???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????? 53635 Query: 120 TCAAACTTCTTATACCACTGCCTCGGAGCTTGCTTCAAACCATACAAGCTCTTCTTCAATCTGCA 184 Sbjct: 53636 ????????????????????????????????????????????????????????????????? 53700 >QHOT2:00025:07130 ACAATAAGCATATTATCAACATAAAGCAACAAAATAACAAAGTCATCATCAGAGAATTTCTGCACAAAAACACAATGGTCAGACGAAGTCTTCTT-AAATCCTGTTGTTTCATAACAAAATCAAACTTCTTATACCACTGCCTCGGAGCTTGCTTCAAACCATACAAGCTCTTCTTCAATCTGCA BLAST Turnera subulata S-locus recessive s-haplotype sequence Sequence ID: MK890303.1Length: 324544Number of Matches: 1 Range 1: 183655 to 183839GenBankGraphics Next Match Previous Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 213 bits(115) 2e-51 162/185(88%) 1/185(0%) Plus/Plus Query 1 ACAATAAGCATATTATCAACATAAAGCAACAAAATAACAAAGTCATCATCAGAGAATTTC 60 ||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 183655 ACAATAAGCATATCATCAACATAGAGCAACAAAATAACAAAGTCATCATCAGAGAATTTT 183714 Query 61 TGCACAAAAACACAATGGTCAGACGAAGTCTTCTTAAATCCT-GTTGTTTCATAACAAAA 119 ||||||||||||||||| ||||| || |||||||| || ||| | | |||||||||| || Sbjct 183715 TGCACAAAAACACAATGATCAGAAGAGGTCTTCTTGAAACCTTGCTTTTTCATAACAGAA 183774 Query 120 TCAAACTTCTTATACCACTGCCTCGGAGCTTGCTTCAAACCATACAAGCTCTTCTTCAAT 179 ||||| || ||||||| ||||| |||||||||||||| ||||| | |||||| |||| Sbjct 183775 TCAAATTTTCTATACCATTGCCTAGGAGCTTGCTTCAAGCCATATAGACTCTTCCTCAAC 183834 Query 180 CTGCA 184 ||||| Sbjct 183835 CTGCA 183839 ~/Elixir/metagenomics/megan/megan6/megan/tools/sam2rma --help ES2 Prism: Error - reported GLX version = 1.2 GLX version 1.3 or higher is required SYNOPSIS SAM2RMA6 [options] DESCRIPTION Computes a MEGAN RMA (.rma) file from a SAM (.sam) file that was created by DIAMOND or MALT OPTIONS Input -i, --in [string(s)] Input SAM file[s] generated by DIAMOND or MALT (gzipped ok). Mandatory option. -r, --reads [string(s)] Reads file(s) (fasta or fastq, gzipped ok). . -mdf, --metaDataFile [string(s)] Files containing metadata to be included in RMA6 files. . Output -o, --out [string(s)] Output file(s), one for each input file, or a directory. Mandatory option. -c, --useCompression Compress reads and matches in RMA file (smaller files, longer to generate. Default value: true. Reads -p, --paired Reads are paired. Default value: false. -ps, --pairedSuffixLength [number] Length of name suffix used to distinguish between name of read and its mate. Default value: 0. Parameters -lg, --longReads Parse and analyse as long reads. Default value: false. -m, --maxMatchesPerRead [number] Max matches per read. Default value: 100. -class, --classify Run classification algorithm. Default value: true. -ms, --minScore [number] Min score. Default value: 50.0. -me, --maxExpected [number] Max expected. Default value: 0.01. -top, --topPercent [number] Top percent. Default value: 10.0. -supp, --minSupportPercent [number] Min support as percent of assigned reads (0==off). Default value: 0.05. -sup, --minSupport [number] Min support. Default value: 0. -mrc, --minPercentReadCover [number] Min percent of read length to be covered by alignments. Default value: 0.0. -mrefc, --minPercentReferenceCover [number] Min percent of reference length to be covered by alignments. Default value: 0.0. -alg, --lcaAlgorithm [string] Set the LCA algorithm to use for taxonomic assignment. Default value: naive. Legal values: naive, weighted, longReads -lcp, --lcaCoveragePercent [number] Set the percent for the LCA to cover. Default value: 100.0. -ram, --readAssignmentMode [string] Set the read assignment mode. Default value: readCount. Legal values: readCount, readLength, alignedBases, readMagnitude -cf, --conFile [string] File of contaminant taxa (one Id or name per line). Classification support: Classification support: -mdb, --mapDB [string] MEGAN mapping db (file megan-map.db). Deprecated classification support options: -tn, --parseTaxonNames Parse taxon names. Default value: true. -a2t, --acc2taxa [string] Accession-to-Taxonomy mapping file. -s2t, --syn2taxa [string] Synonyms-to-Taxonomy mapping file. -a2eggnog, --acc2eggnog [string] Accession-to-EGGNOG mapping file. -s2eggnog, --syn2eggnog [string] Synonyms-to-EGGNOG mapping file. -t4eggnog, --tags4eggnog [string] Tags for EGGNOG id parsing (must set to activate id parsing). -a2interpro2go, --acc2interpro2go [string] Accession-to-INTERPRO2GO mapping file. -s2interpro2go, --syn2interpro2go [string] Synonyms-to-INTERPRO2GO mapping file. -t4interpro2go, --tags4interpro2go [string] Tags for INTERPRO2GO id parsing (must set to activate id parsing). -a2kegg, --acc2kegg [string] Accession-to-KEGG mapping file. -s2kegg, --syn2kegg [string] Synonyms-to-KEGG mapping file. -t4kegg, --tags4kegg [string] Tags for KEGG id parsing (must set to activate id parsing). -a2seed, --acc2seed [string] Accession-to-SEED mapping file. -s2seed, --syn2seed [string] Synonyms-to-SEED mapping file. -t4seed, --tags4seed [string] Tags for SEED id parsing (must set to activate id parsing). -a2vfdb, --acc2vfdb [string] Accession-to-VFDB mapping file. -s2vfdb, --syn2vfdb [string] Synonyms-to-VFDB mapping file. -t4vfdb, --tags4vfdb [string] Tags for VFDB id parsing (must set to activate id parsing). Other: -fwa, --firstWordIsAccession First word in reference header is accession number (set to 'true' for NCBI-nr downloaded Sep 2016 or later). Default value: true. -atags, --accessionTags [string(s)] List of accession tags. Default value(s): gb| ref|.. -v, --verbose Echo commandline options and be verbose. Default value: false. -h, --help Show program usage and quit. AUTHOR(s) Daniel H. Huson. VERSION MEGAN Community Edition (version 6.18.5, built 14 Feb 2020). Copyright (C) 2019 Daniel H. Huson. This program comes with ABSOLUTELY NO WARRANTY..