Edit and Resubmit [Sign in above to save your search strategy] Formatting options Download How to read this page Blast report description

Formatting options
Show	Alignment as Old View Reset form to defaults [?]
Alignment View	[?]
Display	Graphical Overview Linkout Sequence Retrieval NCBI-gi CDS feature [?]
Masking	Character: Color: [?]
Limit results	Descriptions: Graphical overview: Alignments: Line length: [?]
	Organism Type common name, binomial, taxid, or group name. Only 20 top taxa will be shown. Exclude [?]
	Entrez query: [?]
	Expect Min: Expect Max: [?]
	Percent Identity Min: Percent Identity Max: [?]
Format for	PSI-BLAST with inclusion threshold: [?] Format for PSI-BLAST: The Position-Specific Iterated BLAST (PSI-BLAST) program performs iterative searches with a protein query, in which sequences found in one round of search are used to build a custom score model for the next round. more... Inclusion Threshold: This sets the statistical significance threshold for including a sequence in the model used by PSI-BLAST to create the PSSM on the next iteration.

Download
Alignment Text XML ASN.1 JSON Seq-align Hit Table(text) Hit Table(csv) Multiple-file XML2 Single-file XML2 Multiple-file JSON Single-file JSON SAM	Search Strategies ASN.1	PSSM to restart search PSSM	[?]

The Download link provides BLAST output that may be used as input to another program. This includes parseable formats such as the tabular report or XML as well as the Search Strategy files read by the BLAST+ applications. More details on the parseable (XML, tabular, and ASN.1) reports can be found at https://www.ncbi.nlm.nih.gov/books/NBK153387/

The following formats are offered under the Alignment section:
1). "Text". Non-HTML standard BLAST report.
2). "XML". XML report based upon the DTD at https://www.ncbi.nlm.nih.gov/data_specs/dtd/NCBI_BlastOutput.dtd
3). "ASN.1". Alignment written out in Abstract Syntax Notation 1.
4). "JSON Seq-align". Alignment written out in JSON.
4). "Hit Table(text)". The tabular report as text.
5). "Hit Table(csv)". The tabular report ready for import into spread-sheet programs like Excel.
6). "XML2". New XML format described at ftp://ftp.ncbi.nlm.nih.gov/blast/documents/NEWXML/xml2.pdf.
7). "JSON". New JSON format described at ftp://ftp.ncbi.nlm.nih.gov/blast/documents/NEWXML/xml2.pdf.
8). "SAM". Sequence Alignment Map format.

XML2 and JSON can be downloaded either as one file per query (multiple-file) or one file for all queries (single-file). These formats are listed as Multiple-file XML2 (and JSON) or Single-file XML (and JSON).

The following report is offered under the Search Strategy section:
1). "ASN.1" Search Strategy. A record of the parameters, query, and database used in the search. This file can be used to start a stand-alone BLAST search, see https://www.ncbi.nlm.nih.gov/books/NBK1763/#CmdLineAppsManual.I455_BLAST_search_stra

Job title: E7Q0J:01349:11608

RID: VFS74MWY014 (Expires on 09-13 21:28 pm)

Query ID: lcl|Query_82973; lcl|Query_82973
Description: E7Q0J:01349:11608
Molecule type: nucleic acid
Query Length: 187


Database Name: nr
Description: Nucleotide collection (nt) See details
Program: BLASTN 2.7.0+ Citation

Reference

Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14.

Reference - database indexing

Aleksandr Morgulis, George Coulouris, Yan Raytselis, Thomas L. Madden, Richa Agarwala, Alejandro A. Schäffer (2008), "Database Indexing for Production MegaBLAST Searches", Bioinformatics 24:1757-1764.

Other reports: Search Summary [Distance tree of results]

Search Parameters
Search parameter name	Search parameter value
Program	blastn
Word size	28
Expect value	10
Hitlist size	100
Match/Mismatch scores	1,-2
Gapcosts	0,2.5
Low Complexity Filter	Yes
Filter string	L;m;
Genetic Code	1

Database
Database parameter name	Database parameter value
Posted date	Sep 10, 2017 7:25 AM
Number of letters	156,980,978,343
Number of sequences	44,402,363
Entrez query	none

Karlin-Altschul statistics
Params	Ungapped	Gapped
Lambda	1.33271	1.28
K	0.620991	0.46
H	1.12409	0.85

Results Statistics
Results Statistics parameter name	Results Statistics parameter value
Length adjustment	33
Effective length of query	154
Effective length of database	155515700364
Effective search space	23949417856056
Effective search space used	23949417856056

Descriptions

, Reading indexes 1-1, displaying indexes 1-1

Sequences producing significant alignments:

Select:All None Selected:0

Sequences producing significant alignments:
Select for downloading or viewing reports	Description	Max score	Total score	Query cover	E value	Ident	Accession
1Select seq gb\|AC068413.11\|	Homo sapiens chromosome 8, clone RP11-273I9, complete sequence	318	318	100%	3e-83	97%	AC068413.11

Alignments

Download GenBank Graphics Next Previous Descriptions

Homo sapiens chromosome 8, clone RP11-273I9, complete sequence

Sequence ID: AC068413.11Length: 157865Number of Matches: 1

Related Information

Map Viewer-aligned genomic context

Range 1: 41297 to 41483GenBank Graphics Next Match Previous Match

Alignment statistics for match #1
Score	Expect	Identities	Gaps	Strand	Frame
318 bits(172)	3e-83()	184/189(97%)	4/189(2%)	Plus/Plus

Query  1      GAAAGCTGAAATCTTATGAGTAATACTGAGCCACATTTTAAGAGGAAGACATATACGATA  60
              ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
Sbjct  41297  GAAAGCTGAAATCTTATGAGTAATACTGAGCCATATTTTAAGAGGAAGACATATACGATA  41356

Query  61     GAAAGTAACCAAGAAAACAAAACCGTGTTATAGAAAAGATGGCTGAAGGACCTGGGAATA  120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  41357  GAAAGTAACCAAGAAAACAAAACCGTGTTATAGAAAAGATGGCTGAAGGACCTGGGAATA  41416

Query  121    CTTTACCCAGGCTCCAAGAAAGAAAGCTCAAGGTGACATGATTACCAGCTTT-AATATTC  179
               |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||
Sbjct  41417  -TTTACCCAGGCTCC-AGAAAGAAAGCTCAAGGTGACATGATTACCAGCTTTTAATATTC  41474

Query  180    AAA-GCTTG  187
              ||| |||||
Sbjct  41475  AAAAGCTTG  41483

Job title: E7Q0J:01349:11608

Graphic Summary

Distribution of the top 1 Blast Hits on 1 subject sequences [?]

Descriptions

Alignments