Report for Auto_user_IONAS-338-PHlab_170310_PH3R8-22_438
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 9,942.63 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,688.54 |
| Total Number of Reads | 65,401,411 |
| Mean Length [bp] | 152 |
| Longest Read [bp] | 388 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 97.99 | 76.19 |
| Mean Length [bp] | 45 | 37 |
| Longest Alignment [bp] | 328 | 312 |
| Mean Coverage Depth | 0.04× | 0.03× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2017_03_10_12_21_37_user_IONAS-338-PHlab_170310_PH3R8-22 |
|---|---|
| Run Date | 2017-03-10 10:27:15+00:00 |
| Run Flows | 520 |
| Project | PHLab_3RNAseq,LexoGen_QuantSeq |
| Sample | PH3R9-Con2 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | PHlab_AG-3RNA-6samples_PH3R8-14_VZ-3RNA-9samples_PH3R15-22 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-338-PHlab_170310_PH3R8-22_438 |
| Analysis Date | 2017-03-10 |
| runID | 6MVAE |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |