| Total Number of Bases [Mbp] | 3,433.60 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 2,703.75 |
| Total Number of Reads | 28,777,116 |
| Mean Length [bp] | 119 |
| Longest Read [bp] | 402 |
| Genome Name | Homo sapiens |
|---|---|
| Genome Size | 3095693981 |
| Genome Version | hg19 |
| Index Version | tmap-f3 |
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 1,844.57 | 1,502.97 | 1,191.94 |
| Mean Length [bp] | 110 | 98 | 81 |
| Longest Alignment [bp] | 306 | 279 | 261 |
| Mean Coverage Depth | 0.60× | 0.49× | 0.39× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
| Run Name | R_2015_04_28_12_10_54_user_ION-175-PHLab_150428_ChIRP-PHC47-50 |
|---|---|
| Run Date | 2015-04-28 09:12:48+00:00 |
| Run Flows | 520 |
| Project | PHLab_ChIRP |
| Sample | PHC49-Even |
| Library | N/A |
| Reference | hg19 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | PHlab_AG-4ChIRPsamples_PHC47-Input-bc4_PHC48-Odd-bc5_PHC49-Even-bc6_PHC50-LacZ-bc3 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_ION-175-PHLab_150428_ChIRP-PHC47-50_240 |
| Analysis Date | 2015-04-28 |
| runID | 6WA80 |
| Torrent_Suite | 4.4.2 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.8-1 |
| ion-chefupdates | 4.4.5 |
| ion-dbreports | 4.4.29-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.11-1 |
| ion-plugins | 4.4.14-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |