Report for user_ION-164-IT-miRNA_reanalysis_minlength
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 7,132.77 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 5,797.19 |
| Total Number of Reads | 75,502,283 |
| Mean Length [bp] | 94 |
| Longest Read [bp] | 378 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 4,011.86 | 3,395.07 | 2,766.57 |
| Mean Length [bp] | 117 | 106 | 89 |
| Longest Alignment [bp] | 304 | 302 | 293 |
| Mean Coverage Depth | 1.51× | 1.28× | 1.04× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_03_24_11_44_08_user_ION-164-IT-GKlab_150324_ChIP-miRNAtest_ITC46-7_miRNA1-6 |
|---|---|
| Run Date | 2015-03-24 09:46:06+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq,GKLab_miRNAseq |
| Sample | ITC47-Set8KO2input |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_10-ITsamples_ITC46-Set8KO1input-bc4_ITC47-Set8KO2input-bc6_GKlab_FG6miRNA-testsamples_3DifferentExtractionProtocols |
| Barcode Set | IonXpress |
| Analysis Name | user_ION-164-IT-miRNA_reanalysis_minlength |
| Analysis Date | 2015-04-20 |
| runID | UKHW2 |
Software Version
| Torrent_Suite | 4.4.2 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.8-1 |
| ion-chefupdates | 4.4.5 |
| ion-dbreports | 4.4.29-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.11-1 |
| ion-plugins | 4.4.14-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |