Report for Auto_user_ION-137-PHLab_150204_ChIRP-PHC41-46_202
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 8,403.43 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 6,851.36 |
| Total Number of Reads | 68,294,742 |
| Mean Length [bp] | 123 |
| Longest Read [bp] | 381 |
 |  |
Reference Genome Information
| Genome Name | Homo sapiens |
|---|---|
| Genome Size | 3095693981 |
| Genome Version | hg19 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 6,632.16 | 5,667.86 | 4,595.07 |
| Mean Length [bp] | 117 | 106 | 89 |
| Longest Alignment [bp] | 307 | 289 | 283 |
| Mean Coverage Depth | 2.14× | 1.83× | 1.48× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_02_04_12_32_35_user_ION-137-PHLab_150204_ChIRP-PHC41-46 |
|---|---|
| Run Date | 2015-02-04 10:34:37+00:00 |
| Run Flows | 520 |
| Project | PHLab_ChIRP |
| Sample | PHC42-EVEN1 |
| Library | N/A |
| Reference | hg19 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | PHlab_AG-6ChIRP_PHC41-ODD1-bc8_PHC42-EVEN1-bc10_PHC43-LacZ1-bc11_PHC44-ODD2-bc12_PHC45-EVEN2-bc13_PHC46-LacZ2-bc16 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_ION-137-PHLab_150204_ChIRP-PHC41-46_202 |
| Analysis Date | 2015-02-04 |
| runID | H4PGZ |
Software Version
| Torrent_Suite | 4.2.1 |
|---|---|
| Datacollect | 2929 |
| Graphics | 34 |
| LiveView | 1835 |
| OIA | 4201 |
| OS | 21 |
| host | FW7DQV1 |
| ion-analysis | 4.2.18-1 |
| ion-chefupdates | 4.2.0 |
| ion-dbreports | 4.2.22-1 |
| ion-gpu | 4.2.2-1 |
| ion-pipeline | 4.2.12-1 |
| ion-plugins | 4.2.28-1 |
| ion-protonupdates | 4.2.2 |
| ion-torrentr | 4.2.1-1 |