Report for Auto_user_ION-149-ITLab_DrMatis_150220_ITF4r_IMP1-3_214
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 10,983.27 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 8,545.51 |
| Total Number of Reads | 75,133,638 |
| Mean Length [bp] | 146 |
| Longest Read [bp] | 396 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 2,612.24 | 2,161.18 | 1,716.42 |
| Mean Length [bp] | 119 | 106 | 88 |
| Longest Alignment [bp] | 331 | 319 | 306 |
| Mean Coverage Depth | 0.98× | 0.81× | 0.65× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_02_20_12_55_13_user_ION-149-ITLab_DrMatis_150220_ITF4r_IMP1-3_ |
|---|---|
| Run Date | 2015-02-20 10:58:05+00:00 |
| Run Flows | 520 |
| Project | ITLab_FaireSeq,DrMatis_DNA |
| Sample | ITF4r-InputHNFaKO1 |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_YK12FaireSamples_ITF4r-InputHNFaKO1-bc6_DrMatis_3samples_IMP1_4-5-6-7PeptideLinrary-bc9_IMP2_A4VRound4-bc11_IMP3_Ab42Round2-bc15 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_ION-149-ITLab_DrMatis_150220_ITF4r_IMP1-3_214 |
| Analysis Date | 2015-02-20 |
| runID | ETB1X |
Software Version
| Torrent_Suite | 4.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.6-1 |
| ion-chefupdates | 4.4.3 |
| ion-dbreports | 4.4.22-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.9-1 |
| ion-plugins | 4.4.12-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |