Report for Auto_user_IONAS-365-ITlab_170904_ChIP_ITC274-277_469
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 11,483.91 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 9,014.85 |
| Total Number of Reads | 77,483,073 |
| Mean Length [bp] | 148 |
| Longest Read [bp] | 388 |
 |  |
Reference Genome Information
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 0.00 | 0.00 |
| Mean Length [bp] | 0 | 0 |
| Longest Alignment [bp] | 0 | 0 |
Report Information
Analysis Info
| Run Name | R_2017_09_05_14_47_34_user_IONAS-365-ITlab_170904_ChIP_ITC274-277 |
|---|---|
| Run Date | 2017-09-05 11:49:52+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC274-PolII-wt3 |
| Library | N/A |
| Reference | |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab-Tereza_8ChIPseqs_POLII_PartRerunSeq170726 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-365-ITlab_170904_ChIP_ITC274-277_469 |
| Analysis Date | 2017-09-05 |
| runID | JTAPY |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |