Report for Auto_user_IONAS-355-ITLab_170726_ITRC27-41_458
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 7,393.76 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 5,790.81 |
| Total Number of Reads | 51,620,780 |
| Mean Length [bp] | 143 |
| Longest Read [bp] | 401 |
 |  |
Reference Genome Information
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 0.00 | 0.00 |
| Mean Length [bp] | 0 | 0 |
| Longest Alignment [bp] | 0 | 0 |
Report Information
Analysis Info
| Run Name | R_2017_07_26_13_31_42_user_IONAS-355-ITLab_170726_ITRC27-41 |
|---|---|
| Run Date | 2017-07-26 10:33:38+00:00 |
| Run Flows | 520 |
| Project | ITLab_uRNA |
| Sample | ITRC38-EU-DENTC-wt2 |
| Library | N/A |
| Reference | |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_15uRNAs_ITRC27-41 |
| Barcode Set | IonXpressRNA |
| Analysis Name | Auto_user_IONAS-355-ITLab_170726_ITRC27-41_458 |
| Analysis Date | 2017-07-26 |
| runID | 7WZYV |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |