| Total Number of Bases [Mbp] | 10,413.22 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 9,112.42 |
| Total Number of Reads | 75,524,005 |
| Mean Length [bp] | 137 |
| Longest Read [bp] | 380 |
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 2,787.35 | 2,301.02 |
| Mean Length [bp] | 119 | 103 |
| Longest Alignment [bp] | 334 | 320 |
| Mean Coverage Depth | 1.02× | 0.84× |
| Percentage of Library Covered | N/A% | N/A% |
| Run Name | R_2017_06_09_13_18_10_user_IONAS-350-ITlab_170608_ChIP_ITC265-269 |
|---|---|
| Run Date | 2017-06-09 10:20:06+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC268-Mar5 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_EP11samples_ITC265-267_koDENTCP_6MarousoSamples_ITC268-9 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-350-ITlab_170608_ChIP_ITC265-269_453 |
| Analysis Date | 2017-06-09 |
| runID | DKFLP |
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |