| Total Number of Bases [Mbp] | 9,322.77 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,491.04 |
| Total Number of Reads | 90,051,474 |
| Mean Length [bp] | 103 |
| Longest Read [bp] | 394 |
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 0.00 | 0.00 | 0.00 |
| Mean Length [bp] | 0 | 0 | 0 |
| Longest Alignment [bp] | 0 | 0 | 0 |
| Run Name | R_2017_05_16_12_13_35_user_IONAS-345-ITLab_170515_ITR51r-52_ITRC25 |
|---|---|
| Run Date | 2017-05-16 09:15:26+00:00 |
| Run Flows | 520 |
| Project | ITLab_uRNA,ITLab_RNASeq |
| Sample | ITR51r-Set9ko1 |
| Library | N/A |
| Reference | |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_7RNAseqSamples_ITRC2EPsamples |
| Barcode Set | IonXpressRNA |
| Analysis Name | Auto_user_IONAS-345-ITLab_170515_ITR51r-52_ITRC25_448 |
| Analysis Date | 2017-05-16 |
| runID | 0Q5IL |
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |