Report for Auto_user_IONAS-336-ITlab_170216_ChIP_ITC243-246_436
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 6,518.44 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 5,259.01 |
| Total Number of Reads | 51,431,029 |
| Mean Length [bp] | 126 |
| Longest Read [bp] | 396 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 4,045.91 | 3,199.37 |
| Mean Length [bp] | 109 | 90 |
| Longest Alignment [bp] | 318 | 306 |
| Mean Coverage Depth | 1.48× | 1.17× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2017_02_16_12_09_42_user_IONAS-336-ITlab_170216_ChIP_ITC243-246 |
|---|---|
| Run Date | 2017-02-16 10:11:12+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC245-wt1DENTCP-Usp |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_EP28samples_ITC243-246_wt-wtDENTCP-Usp22origene |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-336-ITlab_170216_ChIP_ITC243-246_436 |
| Analysis Date | 2017-02-16 |
| runID | 494AS |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |