Report for Auto_user_IONAS-332-ITlab_170213_ITRC17-23_433
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 2,558.61 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 2,164.21 |
| Total Number of Reads | 66,365,475 |
| Mean Length [bp] | 38 |
| Longest Read [bp] | 399 |
 |  |
Reference Genome Information
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 0.00 | 0.00 |
| Mean Length [bp] | 0 | 0 |
| Longest Alignment [bp] | 0 | 0 |
Report Information
Analysis Info
| Run Name | R_2017_02_14_11_22_48_user_IONAS-332-ITlab_170213_ITRC17-23 |
|---|---|
| Run Date | 2017-02-14 09:24:47+00:00 |
| Run Flows | 520 |
| Project | ITLab_uRNA |
| Sample | ITRC18-wt2Br |
| Library | N/A |
| Reference | |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_6uRNAs_wtvsko_3Br_3Eu |
| Barcode Set | IonXpressRNA |
| Analysis Name | Auto_user_IONAS-332-ITlab_170213_ITRC17-23_433 |
| Analysis Date | 2017-02-14 |
| runID | A00QW |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |