Report for Auto_user_IONAS-324-IT-PHlab_161220_PH3R1-6_ITRC11-13_424
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 6,060.46 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 4,249.92 |
| Total Number of Reads | 60,245,487 |
| Mean Length [bp] | 100 |
| Longest Read [bp] | 401 |
 |  |
Reference Genome Information
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 0.00 | 0.00 |
| Mean Length [bp] | 0 | 0 |
| Longest Alignment [bp] | 0 | 0 |
Report Information
Analysis Info
| Run Name | R_2016_12_20_11_18_53_user_IONAS-324-IT-PHlab_161220_PH3R1-6_ITRC11-13 |
|---|---|
| Run Date | 2016-12-20 09:20:25+00:00 |
| Run Flows | 520 |
| Project | ITLab_uRNA,PHLab_3RNAseq |
| Sample | PH3R4-Ig3-1 |
| Library | N/A |
| Reference | |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | PHLab-6-3RNAseq_ITLab-3of9-uRNAs |
| Barcode Set | IonXpressRNA |
| Analysis Name | Auto_user_IONAS-324-IT-PHlab_161220_PH3R1-6_ITRC11-13_424 |
| Analysis Date | 2016-12-20 |
| runID | 53RDI |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |