Report for Auto_user_IONAS-323-ITlab_161209_ChIP_ITC213-16-219_423
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 8,862.09 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,116.38 |
| Total Number of Reads | 72,876,569 |
| Mean Length [bp] | 121 |
| Longest Read [bp] | 393 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 4,093.21 | 3,287.92 |
| Mean Length [bp] | 102 | 86 |
| Longest Alignment [bp] | 317 | 293 |
| Mean Coverage Depth | 1.50× | 1.21× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_12_09_11_27_01_user_IONAS-323-ITlab_161209_ChIP_ITC213-16-219 |
|---|---|
| Run Date | 2016-12-09 09:28:38+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC213-wt1Me3 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_SG-19samples_ITC213-wt1Me3-bc19_ITC214-wt1TCPMe3-bc20_ITC215-wt3Me1-bc21_ITC216-wt3TCPMe1-bc22_ITC219-SET8ko2TCPINPUT-bc25 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-323-ITlab_161209_ChIP_ITC213-16-219_423 |
| Analysis Date | 2016-12-09 |
| runID | 3FXW7 |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |