Report for Auto_user_IONAS-314-ITlab_161110_CHEF_ChIP_ITC171-174_411
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 10,476.99 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 9,103.05 |
| Total Number of Reads | 71,541,122 |
| Mean Length [bp] | 146 |
| Longest Read [bp] | 389 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 7,009.86 | 5,673.09 |
| Mean Length [bp] | 134 | 113 |
| Longest Alignment [bp] | 341 | 336 |
| Mean Coverage Depth | 2.57× | 2.08× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_11_11_13_36_20_user_IONAS-314-ITlab_161110_CHEF_ChIP_ITC171-174 |
|---|---|
| Run Date | 2016-11-11 11:38:13+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC174-4 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab-24EP-ChIPs_ITC171-1-bc1_ITC172-2-bc2_ITC173-3-bc3_ITC174-4-bc4 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-314-ITlab_161110_CHEF_ChIP_ITC171-174_411 |
| Analysis Date | 2016-11-11 |
| runID | U0RPC |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |