Report for Auto_user_IONAS-310-ITlab_161018_CHEF_ChIP_ITC155-158_407
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 8,586.53 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,408.89 |
| Total Number of Reads | 64,229,830 |
| Mean Length [bp] | 133 |
| Longest Read [bp] | 373 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 5,025.50 | 4,095.09 |
| Mean Length [bp] | 122 | 104 |
| Longest Alignment [bp] | 332 | 323 |
| Mean Coverage Depth | 1.84× | 1.50× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_10_19_14_17_35_user_IONAS-310-ITlab_161018_CHEF_ChIP_ITC155-158 |
|---|---|
| Run Date | 2016-10-19 11:19:48+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC156-FOXAIS2 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab-4YK-ChIPs_ITC155-FOXAIS1-bc1_ITC156-FOXAIS2-bc2_ITC157-FOXAPO1-bc3_ITC158-FOXAPO2-bc4 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-310-ITlab_161018_CHEF_ChIP_ITC155-158_407 |
| Analysis Date | 2016-10-19 |
| runID | FF3BU |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |