Report for IONAS-304-ITLab_MV-MuSeek_160920_ITMu1-2
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 4,579.91 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 3,935.40 |
| Total Number of Reads | 38,524,120 |
| Mean Length [bp] | 118 |
| Longest Read [bp] | 388 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 190.65 | 182.57 |
| Mean Length [bp] | 49 | 47 |
| Longest Alignment [bp] | 265 | 242 |
| Mean Coverage Depth | 0.07× | 0.07× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_09_20_12_11_10_user_IONAS-304-ITLab_KN-uRNA_MV-MuSeek_160920_ITRC1-2_ITMu1-2 |
|---|---|
| Run Date | 2016-09-20 09:12:31+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq,ITLab_ATACseq,ITLab_uRNA |
| Sample | ITRC1a_wtBiotin |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITLab-MVMuSeek-ATACseq_ITMu1_MV1_wtDP_bc1_ITMu2_MV2_BC16koDP_bc2-KNuRNA_ITRC1a_wtBiotin_bc5_ITRC2a_SET8koBiotin_bc6 |
| Barcode Set | MuSeek Barcode set 1 |
| Analysis Name | IONAS-304-ITLab_MV-MuSeek_160920_ITMu1-2 |
| Analysis Date | 2016-09-22 |
| runID | FQ6TW |
Software Version
| Torrent_Suite | 5.0.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.3 |
| ion-dbreports | 5.0.33-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.16-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |