Report for Auto_user_IONAS-297-Lexogen_ITlab_160630_IT3R2-16_395
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 9,471.64 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,527.57 |
| Total Number of Reads | 87,594,880 |
| Mean Length [bp] | 108 |
| Longest Read [bp] | 400 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 2,884.42 | 1,948.00 |
| Mean Length [bp] | 89 | 73 |
| Longest Alignment [bp] | 286 | 270 |
| Mean Coverage Depth | 1.06× | 0.71× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_06_30_12_32_12_user_IONAS-297-Lexogen_ITlab_160630_IT3R2-16 |
|---|---|
| Run Date | 2016-06-30 09:33:46+00:00 |
| Run Flows | 520 |
| Project | LexoGen_QuantSeq,ITLab_3RNAseq |
| Sample | IT3R12-wt5 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | IT3R2-8-Liver_IT3R9-16-8weeks_IonTouch |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-297-Lexogen_ITlab_160630_IT3R2-16_395 |
| Analysis Date | 2016-06-30 |
| runID | A7U2Q |
Software Version
| Torrent_Suite | 5.0.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.3 |
| ion-dbreports | 5.0.33-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.16-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |