Report for Auto_user_IONAS-294-ITlab_160617_ChIP_ITC144-145-154-108_392
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 8,973.19 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,366.67 |
| Total Number of Reads | 68,969,967 |
| Mean Length [bp] | 130 |
| Longest Read [bp] | 385 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 4,485.07 | 3,606.34 |
| Mean Length [bp] | 113 | 94 |
| Longest Alignment [bp] | 315 | 311 |
| Mean Coverage Depth | 1.65× | 1.32× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_06_17_12_24_20_user_IONAS-294-ITlab_160617_ChIP_ITC144-145-154-108 |
|---|---|
| Run Date | 2016-06-17 09:25:54+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC145-InputP60 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab-13YK-FOXA1-ChIPs_ITC144-InputP14-bc4_ITC145-InputP60-bc5_ITC154-Med12P60-bc14_repeat-ITC108-wt1Ser2-bc1 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-294-ITlab_160617_ChIP_ITC144-145-154-108_392 |
| Analysis Date | 2016-06-17 |
| runID | TA46W |
Software Version
| Torrent_Suite | 5.0.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.3 |
| ion-dbreports | 5.0.33-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.16-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |