Report for Auto_user_IONAS-293-ITlab_160613_CHEF_ChIP_ITC150-153_391
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 10,628.41 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 9,059.96 |
| Total Number of Reads | 75,373,776 |
| Mean Length [bp] | 141 |
| Longest Read [bp] | 393 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 6,502.69 | 5,263.52 |
| Mean Length [bp] | 124 | 104 |
| Longest Alignment [bp] | 322 | 308 |
| Mean Coverage Depth | 2.39× | 1.93× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_06_14_14_56_45_user_IONAS-293-ITlab_160613_CHEF_ChIP_ITC150-153 |
|---|---|
| Run Date | 2016-06-14 11:58:46+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC153-P60-2 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab-13YK-FOXA1-ChIPs_ITC150-P14-1-bc10_ITC151-P14-2-bc11_ITC152-P60-1-bc12_ITC153-P60-2-bc13 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-293-ITlab_160613_CHEF_ChIP_ITC150-153_391 |
| Analysis Date | 2016-06-14 |
| runID | TTU8B |
Software Version
| Torrent_Suite | 5.0.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.3 |
| ion-dbreports | 5.0.33-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.16-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |