Report for Auto_user_IONAS-284-ITlab_160322_ChIP_ITC114-117_380
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 9,499.36 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,719.51 |
| Total Number of Reads | 73,121,963 |
| Mean Length [bp] | 129 |
| Longest Read [bp] | 388 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 6,250.71 | 4,969.58 |
| Mean Length [bp] | 113 | 94 |
| Longest Alignment [bp] | 326 | 308 |
| Mean Coverage Depth | 2.35× | 1.87× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_03_22_12_34_57_user_IONAS-284-ITlab_160322_ChIP_ITC114-117 |
|---|---|
| Run Date | 2016-03-22 10:36:31+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC115-wt2Input |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab-28NKChIPs_ITC114-wt1Input-bc4_ITC115-wt2Input-bc5_ITC116-SET9KO1Input-bc6_ITC117-SET9KO2Input-bc7 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-284-ITlab_160322_ChIP_ITC114-117_380 |
| Analysis Date | 2016-03-22 |
| runID | C6UG8 |
Software Version
| Torrent_Suite | 5.0.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.3 |
| ion-dbreports | 5.0.33-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.16-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |