Report for Auto_user_IONAS-274-ITlab_160302_CHEF_ChIP_ITC108-111_370
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 8,471.22 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 6,816.29 |
| Total Number of Reads | 62,955,046 |
| Mean Length [bp] | 134 |
| Longest Read [bp] | 390 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 4,755.52 | 3,767.00 |
| Mean Length [bp] | 116 | 96 |
| Longest Alignment [bp] | 315 | 307 |
| Mean Coverage Depth | 1.74× | 1.38× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_03_03_14_04_25_user_IONAS-274-ITlab_160302_CHEF_ChIP_ITC108-111 |
|---|---|
| Run Date | 2016-03-03 12:07:30+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC110-Set8KO1 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_6-Ser2-ChIPs_ITC108-wt10-bc1_ITC109-wt2-bc2_ITC110-Set8KO1-bc3_ITC111-Set8KO2-bc4 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-274-ITlab_160302_CHEF_ChIP_ITC108-111_370 |
| Analysis Date | 2016-03-03 |
| runID | QI3MD |
Software Version
| Torrent_Suite | 5.0.2 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.7-1 |
| ion-chefupdates | 5.0.1 |
| ion-dbreports | 5.0.19-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.12-1 |
| ion-plugins | 5.0.17-1 |
| ion-protonupdates | 5.0.2 |
| ion-torrentr | 5.0.0-1 |