Report for Auto_user_IONAS-273-ITlab_KNRNAseq_160302_ITR49r-50_369 Library Summary Based on Predicted Per-Base Quality Scores - Independent of Alignment Total Number of Bases [Mbp] 9,822.48 ‣ Number of Q20 Bases [Mbp] 7,603.07 Total Number of Reads 89,704,381 Mean Length [bp] 109 Longest Read [bp] 378 Reference Genome Information Based on Full Library Alignment to Provided Reference AQ20 Perfect Total Number of Bases [Mbp] 0.00 0.00 Mean Length [bp] 0 0 Longest Alignment [bp] 0 0 Test Fragment Report Test Fragment Summary *Test Fragment* *Percent (50AQ17 / Num) * TF_C 77% Test Fragment - TF_C Quality Metrics TF Name TF_C TF Seq TACGAGCGTGTAGACGTGTCGTACGTGCGACGTAGTGAGTATACATGCTC TGACACTATGTACGATCTGAGACTGCCAAGGCACACAGGGGATAGG Num 1,385,443 Avg Q17 read length 71 50AQ17 1,070,639 Graphs Ion Sphere™ Particle (ISP) Identification Summary Report Information Analysis Info Run Name R_2016_03_03_11_22_16_user_IONAS-273-ITlab_KNRNAseq_160302_ITR49r-50 Run Date 2016-03-03 09:24:18+00:00 Run Flows 520 Project ITLab_RNASeq Sample ITR50-wt6 Library N/A Reference Instrument IONAS Flow Order TACGTACGTCTGAGCATCGATCGATGTACAGC Library Key TCAG TF Key ATCG Chip Check Passed Chip Type P1.1.17 Chip Data tiled Notes ITlab_2KNRNAseq_ITR49r-wt1-bc15_ITR50-wt6-bc16 Barcode Set IonXpressRNA Analysis Name Auto_user_IONAS-273-ITlab_KNRNAseq_160302_ITR49r-50_369 Analysis Date 2016-03-03 runID I9Q97 Software Version Torrent_Suite *5.0.2* host FW7DQV1 ion-analysis 5.0.7-1 ion-chefupdates 5.0.1 ion-dbreports 5.0.19-1 ion-gpu 5.0.0-1 ion-pipeline 5.0.12-1 ion-plugins 5.0.17-1 ion-protonupdates 5.0.2 ion-torrentr 5.0.0-1 File Links Developer link: Block stdout Developer link: Block stderr Developer link: std_out_err Plugins Request Support | Help/Documentation | Terms of Use Copyright © 2012 Life Technologies Corporation This product should be used for research use only