Report for Auto_user_IONAS-259-ITlab_151201_ChIP_ITC64-65-74-75_349
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 9,799.40 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,971.04 |
| Total Number of Reads | 73,937,281 |
| Mean Length [bp] | 132 |
| Longest Read [bp] | 384 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 5,996.52 | 4,733.85 |
| Mean Length [bp] | 114 | 94 |
| Longest Alignment [bp] | 319 | 302 |
| Mean Coverage Depth | 2.26× | 1.78× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_12_01_11_54_33_user_IONAS-259-ITlab_151201_ChIP_ITC64-65-74-75 |
|---|---|
| Run Date | 2015-12-01 09:56:34+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC64-wt1PHF8 |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_4-KNsamples-RepeatSeq-ION158-197_ITC64-wt1PHF8-bc11_ITC65-wt2PHF8-bc12_ITC74-Set8ko1PHF8-bc5_ITC75-Set8ko2PHF8-bc6 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-259-ITlab_151201_ChIP_ITC64-65-74-75_349 |
| Analysis Date | 2015-12-01 |
| runID | 74RDN |
Software Version
| Torrent_Suite | 5.0.2 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.7-1 |
| ion-chefupdates | 5.0.1 |
| ion-dbreports | 5.0.19-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.12-1 |
| ion-plugins | 5.0.17-1 |
| ion-protonupdates | 5.0.2 |
| ion-torrentr | 5.0.0-1 |