x/rawdata/: Partition is getting full - 95.02% Visit Data Management
Report for Auto_user_IONAS-237-ITlab_151110_CHEF_ChIP_ITC94-95-96-98_328
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 10,952.80 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 9,432.73 |
| Total Number of Reads | 78,355,799 |
| Mean Length [bp] | 139 |
| Longest Read [bp] | 401 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 7,468.64 | 6,036.37 |
| Mean Length [bp] | 122 | 103 |
| Longest Alignment [bp] | 330 | 315 |
| Mean Coverage Depth | 2.81× | 2.27× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_11_11_11_39_25_user_IONAS-237-ITlab_151110_CHEF_ChIP_ITC94-95-96-98 |
|---|---|
| Run Date | 2015-11-11 09:41:17+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChIPSeq_CHEF |
| Sample | ITC96-wt1Gold48AT |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_8-KNsamples_ITC94-wt1GoldCELL-bc1_ITC95-wt2GoldCELL-bc2_ITC96-wt1Gold48AT-bc3_ITC98-wt1GoldREINB-bc5_CHEF |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-237-ITlab_151110_CHEF_ChIP_ITC94-95-96-98_328 |
| Analysis Date | 2015-11-11 |
| runID | M7HHS |
Software Version
| Torrent_Suite | 5.0.2 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.7-1 |
| ion-chefupdates | 5.0.1 |
| ion-dbreports | 5.0.19-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.12-1 |
| ion-plugins | 5.0.17-1 |
| ion-protonupdates | 5.0.2 |
| ion-torrentr | 5.0.0-1 |