Report for Auto_user_IONAS-214-ITlab_150508_MSChIP_ITC90-93_298
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 8,714.09 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 7,145.77 |
| Total Number of Reads | 67,601,121 |
| Mean Length [bp] | 128 |
| Longest Read [bp] | 394 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 5,185.30 | 4,181.57 |
| Mean Length [bp] | 111 | 93 |
| Longest Alignment [bp] | 311 | 301 |
| Mean Coverage Depth | 1.90× | 1.53× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_08_05_12_38_54_user_IONAS-214-ITlab_150508_MSChIP_ITC90-93 |
|---|---|
| Run Date | 2015-08-05 09:40:39+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-214-ITlab_150508_MSChIP_ITC90-93_298 |
| Analysis Date | 2015-08-05 |
| runID | CX3XH |
Software Version
| Torrent_Suite | 4.6 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.6.11-1 |
| ion-chefupdates | 4.6.0 |
| ion-dbreports | 4.6.24-1 |
| ion-gpu | 4.6.0-1 |
| ion-pipeline | 4.6.11-1 |
| ion-plugins | 4.6.18-1 |
| ion-protonupdates | 4.6.0 |
| ion-torrentr | 4.6.1-1 |