Report for Auto_user_ION-199-ITlab_150617_CHEF_ChIP_ITC82-85_279
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 7,746.18 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 5,982.13 |
| Total Number of Reads | 65,545,530 |
| Mean Length [bp] | 118 |
| Longest Read [bp] | 388 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 4,848.83 | 3,899.48 | 3,190.20 |
| Mean Length [bp] | 102 | 88 | 74 |
| Longest Alignment [bp] | 305 | 299 | 275 |
| Mean Coverage Depth | 1.83× | 1.47× | 1.20× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_06_18_15_59_11_user_ION-199-ITlab_150617_CHEF_ChIP_ITC82-85 |
|---|---|
| Run Date | 2015-06-18 13:24:26+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChIPSeq_CHEF |
| Sample | ITC84-Tub1Smyd |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_20-ITsamples_ITC82-Tub1H4K91-bc1_ITC83-Tub2H4K91-bc2_ITC84-Tub1Smyd-bc3_ITC85-Tub2Smyd-bc4_CHEF |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_ION-199-ITlab_150617_CHEF_ChIP_ITC82-85_279 |
| Analysis Date | 2015-06-18 |
| runID | TZ7EY |
Software Version
| Torrent_Suite | 4.4.3 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.11-1 |
| ion-chefupdates | 4.4.5 |
| ion-dbreports | 4.4.38-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.15-1 |
| ion-plugins | 4.4.23-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |