Report for Auto_user_ION-160-ITlab_150318_ChIP_ITC54-55-68-69_225
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 10,394.60 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 8,093.50 |
| Total Number of Reads | 78,960,422 |
| Mean Length [bp] | 131 |
| Longest Read [bp] | 382 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 7,420.81 | 6,173.26 | 4,958.94 |
| Mean Length [bp] | 119 | 106 | 88 |
| Longest Alignment [bp] | 311 | 304 | 276 |
| Mean Coverage Depth | 2.80× | 2.33× | 1.87× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_03_18_12_47_52_user_ION-160-ITlab_150318_ChIP_ITC54-55-68-69 |
|---|---|
| Run Date | 2015-03-18 10:50:09+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC69-Set8KO2ME1 |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_16-KNsamples_ITC54-wt1Input-bc1_ITC55-wt2Input-bc2_ITC68-Set8KO1ME1-bc15_ITC69-Set8KO2ME1-bc16 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_ION-160-ITlab_150318_ChIP_ITC54-55-68-69_225 |
| Analysis Date | 2015-03-18 |
| runID | ASPUR |
Software Version
| Torrent_Suite | 4.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.6-1 |
| ion-chefupdates | 4.4.3 |
| ion-dbreports | 4.4.22-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.9-1 |
| ion-plugins | 4.4.12-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |