Report for Auto_user_ION-158-ITlab_150317_ChIP_ITC58-59-64-65_223
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 11,316.19 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 9,368.39 |
| Total Number of Reads | 82,870,562 |
| Mean Length [bp] | 136 |
| Longest Read [bp] | 395 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 8,229.97 | 7,094.03 | 5,778.45 |
| Mean Length [bp] | 127 | 116 | 98 |
| Longest Alignment [bp] | 333 | 333 | 308 |
| Mean Coverage Depth | 3.10× | 2.67× | 2.18× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_03_17_12_11_39_user_ION-158-ITlab_150317_ChIP_ITC58-59-64-65_ |
|---|---|
| Run Date | 2015-03-17 10:13:52+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC65-wt2PHF8 |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_16-KNsamples_ITC58-wt1SET8-bc5_ITC59-wt2SET8-bc6_ITC64-wt1PHF8-bc11_ITC65-wt2PHF8-bc12 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_ION-158-ITlab_150317_ChIP_ITC58-59-64-65_223 |
| Analysis Date | 2015-03-17 |
| runID | LKZB7 |
Software Version
| Torrent_Suite | 4.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.6-1 |
| ion-chefupdates | 4.4.3 |
| ion-dbreports | 4.4.22-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.9-1 |
| ion-plugins | 4.4.12-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |