Report for Auto_user_ION-157-ITlab_150313_ChIP_ITC60-63_222
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 11,977.63 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 10,046.26 |
| Total Number of Reads | 82,617,802 |
| Mean Length [bp] | 144 |
| Longest Read [bp] | 394 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 9,621.19 | 8,340.02 | 6,666.33 |
| Mean Length [bp] | 136 | 124 | 104 |
| Longest Alignment [bp] | 340 | 340 | 318 |
| Mean Coverage Depth | 3.62× | 3.14× | 2.51× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_03_13_12_30_26_user_ION-157-ITlab_150313_ChIP_ITC60-63 |
|---|---|
| Run Date | 2015-03-13 10:32:22+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC60-wt1POL2 |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_16-KNsamples_ITC60-wt1POL2-bc7_ITC61-wt2POL2-bc8_ITC62-Set8KO1POL2-bc9_ITC63-Set8KO2POL2-bc10 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_ION-157-ITlab_150313_ChIP_ITC60-63_222 |
| Analysis Date | 2015-03-13 |
| runID | TIGEK |
Software Version
| Torrent_Suite | 4.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.6-1 |
| ion-chefupdates | 4.4.3 |
| ion-dbreports | 4.4.22-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.9-1 |
| ion-plugins | 4.4.12-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |