| Total Number of Bases [Mbp] | 10,343.53 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 8,870.86 |
| Total Number of Reads | 74,813,096 |
| Mean Length [bp] | 138 |
| Longest Read [bp] | 391 |
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 7,705.16 | 6,752.70 | 5,515.49 |
| Mean Length [bp] | 130 | 120 | 102 |
| Longest Alignment [bp] | 333 | 324 | 314 |
| Mean Coverage Depth | 2.90× | 2.54× | 2.08× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
| Run Name | R_2015_03_12_12_59_17_user_ION-156-ITlab_150312_ChIP_ITC44-45-48-49 |
|---|---|
| Run Date | 2015-03-12 11:01:14+00:00 |
| Run Flows | 520 |
| Project | ITLab_ChipSeq |
| Sample | ITC49-wt2SET8 |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | ITlab_10-ITsamples_ITC44-wt1Input-bc2_ITC45-wt2Input-bc3_ITC48-wt1SET8-bc8_ITC49-wt2SET8-bc10 |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_ION-156-ITlab_150312_ChIP_ITC44-45-48-49_221 |
| Analysis Date | 2015-03-12 |
| runID | BRUU9 |
| Torrent_Suite | 4.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.6-1 |
| ion-chefupdates | 4.4.3 |
| ion-dbreports | 4.4.22-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.9-1 |
| ion-plugins | 4.4.12-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |