Report for Auto_user_ION-165-IRLab_KR-MuSeek_150331_ATACseq_IRMu8-9_230
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 3,686.30 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 2,782.87 |
| Total Number of Reads | 40,734,782 |
| Mean Length [bp] | 90 |
| Longest Read [bp] | 384 |
 |  |
Reference Genome Information
| Genome Name | Homo sapiens |
|---|---|
| Genome Size | 3095693981 |
| Genome Version | hg19 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 2,559.70 | 2,090.94 | 1,798.16 |
| Mean Length [bp] | 85 | 76 | 68 |
| Longest Alignment [bp] | 230 | 220 | 203 |
| Mean Coverage Depth | 0.83× | 0.68× | 0.58× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_03_31_11_57_46_user_ION-165-IRLab_KR-MuSeek_150331_ATACseq_IRMu8-9 |
|---|---|
| Run Date | 2015-03-31 09:00:09+00:00 |
| Run Flows | 520 |
| Project | IRLab_ATACseq |
| Sample | IRMu9-R2 |
| Library | N/A |
| Reference | hg19 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | IRlam_KRMuSeeksamples_IRMu8-Rep1-bc6_IRMu9-Rep2-bc10 |
| Barcode Set | MuSeek Barcode set 1 |
| Analysis Name | Auto_user_ION-165-IRLab_KR-MuSeek_150331_ATACseq_IRMu8-9_230 |
| Analysis Date | 2015-03-31 |
| runID | YFQV3 |
Software Version
| Torrent_Suite | 4.4.2 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.8-1 |
| ion-chefupdates | 4.4.5 |
| ion-dbreports | 4.4.29-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.11-1 |
| ion-plugins | 4.4.14-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |