Report for Auto_user_ION-153-IRLab_KR-MuSeek_150303_ATACseq_IRMu5-6_218
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 7,159.19 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 5,680.34 |
| Total Number of Reads | 63,383,249 |
| Mean Length [bp] | 112 |
| Longest Read [bp] | 384 |
 |  |
Reference Genome Information
| Genome Name | Homo sapiens |
|---|---|
| Genome Size | 3095693981 |
| Genome Version | hg19 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 4,942.89 | 4,158.00 | 3,531.54 |
| Mean Length [bp] | 96 | 87 | 77 |
| Longest Alignment [bp] | 217 | 196 | 192 |
| Mean Coverage Depth | 1.60× | 1.34× | 1.14× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_03_03_12_03_59_user_ION-153-IRLab_KR-MuSeek_150303_ATACseq_IRMu5-6 |
|---|---|
| Run Date | 2015-03-03 10:05:56+00:00 |
| Run Flows | 520 |
| Project | IRLab_ATACseq |
| Sample | IRMu6-gDNA |
| Library | N/A |
| Reference | hg19 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | IRLab_KR-2MuSeekSamples_IRMu6-gDNA-bc5_IRMu7-Nuclei-bc7 |
| Barcode Set | MuSeek Barcode set 1 |
| Analysis Name | Auto_user_ION-153-IRLab_KR-MuSeek_150303_ATACseq_IRMu5-6_218 |
| Analysis Date | 2015-03-03 |
| runID | UFL3R |
Software Version
| Torrent_Suite | 4.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.6-1 |
| ion-chefupdates | 4.4.3 |
| ion-dbreports | 4.4.22-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.9-1 |
| ion-plugins | 4.4.12-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |