Report for Auto_user_ION-138-IRLab_KR-MuSeek_150204_ATACseq_IRMu5_203
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 2,987.86 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 2,285.93 |
| Total Number of Reads | 33,399,011 |
| Mean Length [bp] | 89 |
| Longest Read [bp] | 358 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 2,001.92 | 1,685.77 | 1,547.89 |
| Mean Length [bp] | 83 | 75 | 70 |
| Longest Alignment [bp] | 188 | 174 | 166 |
| Mean Coverage Depth | 0.75× | 0.63× | 0.58× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_02_04_15_42_26_user_ION-138-IRLab_KR-MuSeek_150204_ATACseq_IRMu5 |
|---|---|
| Run Date | 2015-02-04 13:44:10+00:00 |
| Run Flows | 520 |
| Project | IRLab_ATACseq |
| Sample | IRMu5-Nuclei |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | IRLab_KR-1MuSeekSample_IRMu5-Nuclei-bc2 |
| Barcode Set | MuSeek Barcode set 1 |
| Analysis Name | Auto_user_ION-138-IRLab_KR-MuSeek_150204_ATACseq_IRMu5_203 |
| Analysis Date | 2015-02-04 |
| runID | W5GVU |
Software Version
| Torrent_Suite | 4.2.1 |
|---|---|
| Datacollect | 2929 |
| Graphics | 34 |
| LiveView | 1835 |
| OIA | 4201 |
| OS | 21 |
| host | FW7DQV1 |
| ion-analysis | 4.2.18-1 |
| ion-chefupdates | 4.2.0 |
| ion-dbreports | 4.2.22-1 |
| ion-gpu | 4.2.2-1 |
| ion-pipeline | 4.2.12-1 |
| ion-plugins | 4.2.28-1 |
| ion-protonupdates | 4.2.2 |
| ion-torrentr | 4.2.1-1 |