Report for Auto_user_ION-183-GPLab_150508_MCRNAseq_GPR4-7_262
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 4,258.85 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 3,585.11 |
| Total Number of Reads | 46,602,581 |
| Mean Length [bp] | 91 |
| Longest Read [bp] | 390 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 3,016.98 | 2,619.40 | 2,415.18 |
| Mean Length [bp] | 80 | 74 | 69 |
| Longest Alignment [bp] | 273 | 264 | 248 |
| Mean Coverage Depth | 1.14× | 0.99× | 0.91× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_05_08_14_07_24_user_ION-183-GPLab_150508_MCRNAseq_GPR4-7 |
|---|---|
| Run Date | 2015-05-08 11:09:39+00:00 |
| Run Flows | 520 |
| Project | GPlab_RNAseq |
| Sample | GPR7-784 |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | GPlab_MC-8RNAseq_GPR4-TgArs-787B-bc7_GPR7-CtrlArs-784B-bc5 |
| Barcode Set | IonXpressRNA |
| Analysis Name | Auto_user_ION-183-GPLab_150508_MCRNAseq_GPR4-7_262 |
| Analysis Date | 2015-05-08 |
| runID | RIOB0 |
Software Version
| Torrent_Suite | 4.4.3 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.11-1 |
| ion-chefupdates | 4.4.5 |
| ion-dbreports | 4.4.38-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.15-1 |
| ion-plugins | 4.4.23-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |