| Total Number of Bases [Mbp] | 6,811.21 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 5,749.26 |
| Total Number of Reads | 69,347,544 |
| Mean Length [bp] | 98 |
| Longest Read [bp] | 399 |
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 4,523.59 | 3,937.20 | 3,587.75 |
| Mean Length [bp] | 82 | 76 | 71 |
| Longest Alignment [bp] | 277 | 271 | 257 |
| Mean Coverage Depth | 1.70× | 1.48× | 1.35× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
| Run Name | R_2015_05_06_14_42_12_user_ION-179-PGLab_150506_MCRNAseq_GPR2-5 |
|---|---|
| Run Date | 2015-05-06 11:44:52+00:00 |
| Run Flows | 520 |
| Project | GPlab_RNAseq |
| Sample | GPR5-788 |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | GPlab_MC-8RNAseq_GPR2-TgSal-786-bc2_GPR5-DtrlSal-788-bc5 |
| Barcode Set | IonXpressRNA |
| Analysis Name | Auto_user_ION-179-PGLab_150506_MCRNAseq_GPR2-5_249 |
| Analysis Date | 2015-05-06 |
| runID | 5OUY5 |
| Torrent_Suite | 4.4.3 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.11-1 |
| ion-chefupdates | 4.4.5 |
| ion-dbreports | 4.4.38-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.15-1 |
| ion-plugins | 4.4.23-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |