Report for Auto_user_IONAS-317-DrSpilian_GKlab_161122_BSC1r-4r_GK3R78-86_415
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 7,555.25 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 5,785.25 |
| Total Number of Reads | 67,243,421 |
| Mean Length [bp] | 112 |
| Longest Read [bp] | 390 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 3,273.63 | 2,494.28 |
| Mean Length [bp] | 95 | 79 |
| Longest Alignment [bp] | 306 | 291 |
| Mean Coverage Depth | 1.20× | 0.92× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_11_22_11_28_55_user_IONAS-317-DrSpilian_GKlab_161122_BSC1r-4r_GK3R78-86 |
|---|---|
| Run Date | 2016-11-22 09:30:30+00:00 |
| Run Flows | 520 |
| Project | DrSpilianakis_ChIPseq,LexoGen_QuantSeq,GKLab_3RNAseq |
| Sample | BSC4r-I |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | DrSpilian_RepeatSeq160524-afterFragmofSamples_GKlab-VK9-3RNAseq |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-317-DrSpilian_GKlab_161122_BSC1r-4r_GK3R78-86_415 |
| Analysis Date | 2016-11-22 |
| runID | JB9UG |
Software Version
| Torrent_Suite | 5.0.5 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.7 |
| ion-dbreports | 5.0.34-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.17-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |