Report for Auto_user_IONAS-307-GKlab_MS_160928_GK3R55--77_405
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 8,398.35 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 6,543.26 |
| Total Number of Reads | 78,080,069 |
| Mean Length [bp] | 107 |
| Longest Read [bp] | 385 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 65.73 | 45.51 |
| Mean Length [bp] | 91 | 76 |
| Longest Alignment [bp] | 276 | 240 |
| Mean Coverage Depth | 0.02× | 0.02× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_09_28_11_13_05_user_IONAS-307-GKlab_MS_160928_GK3R55--77 |
|---|---|
| Run Date | 2016-09-28 08:14:43+00:00 |
| Run Flows | 520 |
| Project | LexoGen_QuantSeq,GKLab_3RNAseq |
| Sample | GK3R75r-MS22 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | GK3R55--77_MSakkou_14samples_7resequenced_7newlibrary |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-307-GKlab_MS_160928_GK3R55--77_405 |
| Analysis Date | 2016-09-28 |
| runID | D13ZT |
Software Version
| Torrent_Suite | 5.0.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.3 |
| ion-dbreports | 5.0.33-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.16-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |