Report for Auto_user_IONAS-303-GKlab_MA_160909_GK3R39-53_401
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 8,514.00 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 6,710.65 |
| Total Number of Reads | 81,751,247 |
| Mean Length [bp] | 104 |
| Longest Read [bp] | 394 |
 |  |
Reference Genome Information
| Genome Name | mm10 |
|---|---|
| Genome Size | 2725537669 |
| Genome Version | 1 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ20 | Perfect | |
|---|---|---|
| Total Number of Bases [Mbp] | 2,726.67 | 1,958.77 |
| Mean Length [bp] | 87 | 74 |
| Longest Alignment [bp] | 284 | 284 |
| Mean Coverage Depth | 1.00× | 0.72× |
| Percentage of Library Covered | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2016_09_09_12_00_04_user_IONAS-303-GKlab_MA_160909_GK3R39-53 |
|---|---|
| Run Date | 2016-09-09 09:01:28+00:00 |
| Run Flows | 520 |
| Project | LexoGen_QuantSeq,GKLab_3RNAseq |
| Sample | GK3R53-MA44 |
| Library | N/A |
| Reference | mm10 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | GK3R39-53_MArmaka_final15of44samples |
| Barcode Set | IonXpress |
| Analysis Name | Auto_user_IONAS-303-GKlab_MA_160909_GK3R39-53_401 |
| Analysis Date | 2016-09-09 |
| runID | N1ZBX |
Software Version
| Torrent_Suite | 5.0.4 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 5.0.13-1 |
| ion-chefupdates | 5.0.3 |
| ion-dbreports | 5.0.33-1 |
| ion-gpu | 5.0.0-1 |
| ion-pipeline | 5.0.16-1 |
| ion-plugins | 5.0.28-1 |
| ion-protonupdates | 5.0.3 |
| ion-torrentr | 5.0.0-1 |