Report for Auto_user_ION-205-GKlab_VNRNAseq_150708_CHEF_GKR28-29_289
Library Summary
Based on Predicted Per-Base Quality Scores - Independent of Alignment
| Total Number of Bases [Mbp] | 12,108.80 |
|---|---|
| ‣ Number of Q20 Bases [Mbp] | 9,943.48 |
| Total Number of Reads | 85,367,041 |
| Mean Length [bp] | 141 |
| Longest Read [bp] | 389 |
 |  |
Reference Genome Information
| Genome Name | Mus musculus |
|---|---|
| Genome Size | 2654911517 |
| Genome Version | mm9 |
| Index Version | tmap-f3 |
Based on Full Library Alignment to Provided Reference
| AQ17 | AQ20 | Perfect | |
|---|---|---|---|
| Total Number of Bases [Mbp] | 7,075.55 | 5,986.55 | 4,932.83 |
| Mean Length [bp] | 108 | 98 | 83 |
| Longest Alignment [bp] | 326 | 309 | 296 |
| Mean Coverage Depth | 2.67× | 2.25× | 1.86× |
| Percentage of Library Covered | N/A% | N/A% | N/A% |
Report Information
Analysis Info
| Run Name | R_2015_07_10_12_30_50_user_ION-205-GKlab_VNRNAseq_150708_CHEF_GKR28-29_ |
|---|---|
| Run Date | 2015-07-10 09:32:58+00:00 |
| Run Flows | 520 |
| Project | GKLab_RNASeq |
| Sample | GKR29-III6h |
| Library | N/A |
| Reference | mm9 |
| Instrument | IONAS |
| Flow Order | TACGTACGTCTGAGCATCGATCGATGTACAGC |
| Library Key | TCAG |
| TF Key | ATCG |
| Chip Check | Passed |
| Chip Type | P1.1.17 |
| Chip Data | tiled |
| Notes | GKlab_VN-18RNAsamples_GKR28-III3h-bc9_GKR29-III6h-bc10 |
| Barcode Set | IonXpressRNA |
| Analysis Name | Auto_user_ION-205-GKlab_VNRNAseq_150708_CHEF_GKR28-29_289 |
| Analysis Date | 2015-07-10 |
| runID | ALDG1 |
Software Version
| Torrent_Suite | 4.4.3 |
|---|---|
| host | FW7DQV1 |
| ion-analysis | 4.4.11-1 |
| ion-chefupdates | 4.4.5 |
| ion-dbreports | 4.4.38-1 |
| ion-gpu | 4.4.1-1 |
| ion-pipeline | 4.4.15-1 |
| ion-plugins | 4.4.23-1 |
| ion-protonupdates | 4.4.3 |
| ion-torrentr | 4.4.0-1 |