reczko@fix:/data/images/proton/DKlab/mr/parclip/suite/Parclip_suite_v1$ ./prepare_fasta.pl ../test/test.fastq t test Converting FASTQ to FASTA: .//fastq2fasta.pl ../test/test.fastq > test/t.fasta Converting FASTQ to FASTA: cutadapt test/t.fasta -a TCGTATGCCGTCTTCTGCTTG -g AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACGATC -b CGTACGCGGGTTTAAACGA -b CTCATCTTGGTCGTACGCGGAATAGTTTAAACTGT > test/t.cfasta This is cutadapt 1.10 with Python 2.7.9 Command line parameters: test/t.fasta -a TCGTATGCCGTCTTCTGCTTG -g AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACGATC -b CGTACGCGGGTTTAAACGA -b CTCATCTTGGTCGTACGCGGAATAGTTTAAACTGT Trimming 4 adapters with at most 10.0% errors in single-end mode ... Finished in 0.42 s (34 us/read; 1.78 M reads/minute). === Summary === Total reads processed: 12,500 Reads with adapters: 11,600 (92.8%) Reads written (passing filters): 12,500 (100.0%) Total basepairs processed: 450,000 bp Total written (filtered): 285,271 bp (63.4%) === Adapter 1 === Sequence: TCGTATGCCGTCTTCTGCTTG; Type: regular 3'; Length: 21; Trimmed: 11103 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-21 bp: 2 Bases preceding removed adapters: A: 10.1% C: 7.5% G: 74.5% T: 6.1% none/other: 1.8% Overview of removed sequences length count expect max.err error counts 3 270 195.3 0 270 4 273 48.8 0 273 5 315 12.2 0 315 6 297 3.1 0 297 7 375 0.8 0 375 8 441 0.2 0 441 9 474 0.0 0 473 1 10 483 0.0 1 468 15 11 606 0.0 1 581 25 12 584 0.0 1 551 33 13 744 0.0 1 637 107 14 877 0.0 1 844 33 15 890 0.0 1 853 37 16 761 0.0 1 697 64 17 908 0.0 1 882 26 18 649 0.0 1 633 16 19 520 0.0 1 463 57 20 448 0.0 2 440 7 1 21 363 0.0 2 354 9 22 216 0.0 2 210 6 23 149 0.0 2 147 0 2 24 83 0.0 2 83 25 61 0.0 2 58 2 1 26 44 0.0 2 44 27 25 0.0 2 25 28 16 0.0 2 16 29 10 0.0 2 9 1 30 6 0.0 2 6 31 19 0.0 2 19 32 2 0.0 2 1 1 33 1 0.0 2 1 35 1 0.0 2 1 36 192 0.0 2 167 13 12 === Adapter 2 === Sequence: CGTACGCGGGTTTAAACGA; Type: variable 5'/3'; Length: 19; Trimmed: 54 times. 34 times, it overlapped the 5' end of a read 20 times, it overlapped the 3' end or was within the read No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1 Overview of removed sequences (5') length count expect max.err error counts 3 20 195.3 0 20 4 1 48.8 0 1 5 6 12.2 0 6 19 7 0.0 1 5 2 Overview of removed sequences (3' or within) length count expect max.err error counts 3 18 195.3 0 18 4 2 48.8 0 2 === Adapter 3 === Sequence: CTCATCTTGGTCGTACGCGGAATAGTTTAAACTGT; Type: variable 5'/3'; Length: 35; Trimmed: 70 times. 23 times, it overlapped the 5' end of a read 47 times, it overlapped the 3' end or was within the read No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-35 bp: 3 Overview of removed sequences (5') length count expect max.err error counts 3 4 195.3 0 4 5 7 12.2 0 7 24 12 0.0 2 7 4 1 Overview of removed sequences (3' or within) length count expect max.err error counts 3 36 195.3 0 36 4 8 48.8 0 8 5 1 12.2 0 1 6 2 3.1 0 2 === Adapter 4 === Sequence: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACGATC; Type: regular 5'; Length: 49; Trimmed: 373 times. No. of allowed errors: 0-9 bp: 0; 10-19 bp: 1; 20-29 bp: 2; 30-39 bp: 3; 40-49 bp: 4 Overview of removed sequences length count expect max.err error counts 3 25 195.3 0 25 4 5 48.8 0 5 5 6 12.2 0 6 7 10 0.8 0 10 8 5 0.2 0 5 9 2 0.0 0 2 10 3 0.0 1 1 2 11 7 0.0 1 6 1 12 4 0.0 1 4 13 4 0.0 1 4 14 5 0.0 1 4 1 15 2 0.0 1 2 16 5 0.0 1 5 17 14 0.0 1 7 7 18 13 0.0 1 9 4 19 78 0.0 1 1 77 20 55 0.0 2 36 14 5 21 26 0.0 2 1 18 7 22 38 0.0 2 11 15 12 23 29 0.0 2 16 11 2 24 25 0.0 2 19 5 1 25 12 0.0 2 9 2 1 Collapsing FASTA: .//fasta2unique.pl test/t.cfasta > test/t.fau Cleaning temporary files... Done. Use file test/t.fau for further analysis #@step2 reczko@fix:/data/images/proton/DKlab/mr/parclip/suite/Parclip_suite_v1$ ./analyze_parclip.pl test/t.fau t 15 50 /data/images/proton/DKlab/mr/parclip/suite/Parclip_suite_v1/Human_transcriptome_reference/Human_transcriptome_reference.conf testout Executing: .//fasta_split_by_letter.pl test/t.fau 15 50 AA > testout/t_AA.fa reczko@fix:/data/images/proton/DKlab/mr/parclip/suite/Parclip_suite_v1$ ./analyze_parclip.pl test/t.fau t 15 50 /data/images/proton/DKlab/mr/parclip/suite/Parclip_suite_v1/Human_transcriptome_reference/Human_transcriptome_reference.conf testout ... bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/others testout/t_GG.fa > .//testout/t_GG_res.anno_bwt_t # reads processed: 391 # reads with at least one reported alignment: 20 (5.12%) # reads that failed to align: 371 (94.88%) Reported 163 alignments to 1 output stream(s) Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/genome testout/t_GG.fa > .//testout/t_GG_res.anno_bwt_t # reads processed: 391 # reads with at least one reported alignment: 111 (28.39%) # reads that failed to align: 280 (71.61%) Reported 981 alignments to 1 output stream(s) Start parsing rm: cannot remove './/testout/t_GG_res.anno_bwt.gz': No such file or directory Executing: .//annotate.pl ./ testout/t_GC.fa /data/images/proton/DKlab/mr/parclip/suite/Parclip_suite_v1/Human_transcriptome_reference/Human_transcriptome_reference.conf testout/t_GC_res Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/adapter testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/marker testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/plasmid testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 10 (3.14%) # reads that failed to align: 308 (96.86%) Reported 38 alignments to 1 output stream(s) Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/rRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/Mt_rRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/tRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 2 (0.63%) # reads that failed to align: 316 (99.37%) Reported 36 alignments to 1 output stream(s) Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/Mt_tRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/snRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 7 (2.20%) # reads that failed to align: 311 (97.80%) Reported 140 alignments to 1 output stream(s) Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/snoRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/scRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/scaRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/miRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 0 (0.00%) # reads that failed to align: 318 (100.00%) No alignments Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/mRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 44 (13.84%) # reads that failed to align: 274 (86.16%) Reported 351 alignments to 1 output stream(s) Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/mRNA_prec testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 69 (21.70%) # reads that failed to align: 249 (78.30%) Reported 432 alignments to 1 output stream(s) Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/lincRNA testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 10 (3.14%) # reads that failed to align: 308 (96.86%) Reported 47 alignments to 1 output stream(s) Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/others testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 14 (4.40%) # reads that failed to align: 304 (95.60%) Reported 61 alignments to 1 output stream(s) Executing: bowtie --sam -v 2 -p 8 -f -k 20 ./Human_transcriptome_reference/genome testout/t_GC.fa > .//testout/t_GC_res.anno_bwt_t # reads processed: 318 # reads with at least one reported alignment: 83 (26.10%) # reads that failed to align: 235 (73.90%) Reported 566 alignments to 1 output stream(s) Start parsing rm: cannot remove './/testout/t_GC_res.anno_bwt.gz': No such file or directory Executing: ls testout/t_??_res.anno > testout/t_anno.lst Executing: .//an_anno_lst.pl testout/t_anno.lst testout/t_fa.lst /data/images/proton/DKlab/mr/parclip/suite/Parclip_suite_v1/Human_transcriptome_reference/Human_transcriptome_reference.conf testout/t 15 50 reczko@fix:/data/images/proton/DKlab/mr/parclip/suite/Parclip_suite_v1$ #@ reczko@fix:/data/images/proton/DKlab/mr/parclip/suite$ tar tzf Hum_tra_ref_source.tar.gz ./ ./Mt_tRNA.fa ./snRNA.fa ./mRNA_prec.fa ./scaRNA.fa ./rRNA.fa ./Mt_rRNA.fa ./lincRNA.fa ./scRNA.fa ./plasmid.fa ./others.fa ./adapter.fa ./marker.fa ./snoRNA.fa ./miRNA.fa ./mRNA.fa ./genome.fa