PARCLIP Pipeline

Created by Bpipe, Tue Sep 26 18:26:07 EEST 2017

Result

Timeline

Pipeline Stages

Total Runtime = 6 minutes, 51.595 seconds

1. preprocess ✓

   fastqToFASTA.pl v2.0 and collapseFA.pl v2.0

   Inputs	test.fastq
   Commands	cat test.fastq | ../scripts/fastqToFASTA.pl 2> test.fastq.processing | cutadapt -a TCGTATGCCGTCTTCTGCTTG -g AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACGATC -b CGTACGCGGGTTTAAACGA -b CGTACGCGGAATAGTTTAAACTGT -n 1 -m 20 - 2>> test.fastq.processing | ../scripts/collapseFA.pl > test.fasta
   Outputs	test.fasta
   Execution Time	2017-9-26 18:19:15 - 2017-9-26 18:21:58 (2 minutes, 42.916 seconds)

2. align ✓

   filterSAMMultiMapperTC.pl v2.0

   Inputs	test.fasta
   Commands	bowtie /data/results/reference/mmu/mm10/Mus_musculus/UCSC/mm10/Sequence/BowtieIndex/genome -v 2 -m 10 --best --strata -p 8 -S --un unaligned_test.fasta -f test.fasta --quiet | samtools view -hS -F 4 - > test.aligned.sam
   Outputs	test.aligned.sam
   Tools	samtools : 0.1.19-44428cd - A suite of utilities for sorting, indexing, viewing and calling variants on NGS data bowtie : 0.12.9
   Execution Time	2017-9-26 18:21:58 - 2017-9-26 18:23:44 (1 minutes, 45.619 seconds)

3. PARparams ✓

   editPARalyzerINIfile.pl v2.0

   Inputs	test.aligned.sam
   Commands	perl ../scripts/editPARalyzerINIfile.pl ../scripts/Default_PARalyzer_Parameters.ini test.aligned.sam /data/results/reference/mmu/mm10/Mus_musculus/UCSC/mm10/Sequence/WholeGenomeFasta/genome.2bit > test.ini
   Outputs	test.ini
   Execution Time	2017-9-26 18:23:44 (0.153 seconds)

4. PARalyze ✓

   Inputs	test.ini
   Commands	../scripts/PARalyzer 20G test.ini mv test_PARalyzer_Utilized.sam test.sam
   Outputs	test.clusters
   Execution Time	2017-9-26 18:23:44 - 2017-9-26 18:24:7 (22.816 seconds)

5. sam2bam ✓

   Inputs	test.clusters test.groups test.distribution test.sam
   Commands	samtools view -bhS test.sam | samtools sort -o - - > test.bam
   Outputs	test.bam
   Tools	samtools : 0.1.19-44428cd - A suite of utilities for sorting, indexing, viewing and calling variants on NGS data
   Execution Time	2017-9-26 18:24:7 - 2017-9-26 18:24:9 (1.798 seconds)

6. index ✓

   Inputs	test.bam
   Commands	samtools index test.bam
   Outputs	test.bam.bai
   Tools	samtools : 0.1.19-44428cd - A suite of utilities for sorting, indexing, viewing and calling variants on NGS data
   Execution Time	2017-9-26 18:24:9 (0.183 seconds)

7. readAttributes ✓

   readAttributesTC.pl v2.0

   Inputs	test.sam
   Commands	../scripts/readAttributesTC.pl test.sam > test.attr
   Outputs	test.attr
   Execution Time	2017-9-26 18:24:9 - 2017-9-26 18:24:11 (2.101 seconds)

8. annotateReads ✓

   Inputs	test.attr
   Commands	../scripts/annotate.pl -g ../files/gencode.vM2.chr_patch_hapl_scaff.annotation.gtf -p ../scripts/annotationRank.txt -r ../files/hg19_rmsk.bed.gz -s ../files/hg19_rmsk_info -strict -oi test.attr > test.readcsv
   Outputs	test.readcsv
   Execution Time	2017-9-26 18:24:11 - 2017-9-26 18:24:53 (41.659 seconds)

9. read_bed ✓

   reads2bed.pl v2.0

   Inputs	test.readcsv
   Commands	../scripts/reads2bed.py test.readcsv > test.readbed
   Outputs	test.readbed
   Execution Time	2017-9-26 18:24:53 (0.596 seconds)

10. annotateClusters ✓

    PARclusters2bed.py v2.0

    Inputs	test.clusters
    Commands	../scripts/annotate.pl -g ../files/gencode.vM2.chr_patch_hapl_scaff.annotation.gtf -p ../scripts/annotationRank.txt -r ../files/hg19_rmsk.bed.gz -s ../files/hg19_rmsk_info -strict -oi test.clusters | ../scripts/PARclusters2bed.py > test.clusterbed
    Outputs	test.clusterbed
    Execution Time	2017-9-26 18:24:53 - 2017-9-26 18:25:10 (16.842 seconds)

11. addInfo ✓

    editClustersTC.pl v2.0

    Inputs	test.readbed test.clusterbed
    Commands	intersectBed -a test.readbed -b test.clusterbed -wao -s | awk -F " " 'BEGIN{OFS=",";} { print $5,$7,$8,$9,$11,$12}' | sed '/,\-1/d' | ../scripts/editClustersTC.pl .6 > test.clusters.csv
    Outputs	test.clusters.csv
    Execution Time	2017-9-26 18:25:10 - 2017-9-26 18:25:11 (1.417 seconds)

12. visbed ✓

    visclusterbed.py v2.0

    Inputs	test.clusters.csv
    Commands	cat test.clusters.csv | ../scripts/visclusterbed.py > test.clusters.bed
    Outputs	test.clusters.bed
    Execution Time	2017-9-26 18:25:11 (0.247 seconds)

13. geneLvl ✓

    geneLevel.pl v1.0

    Inputs	test.clusters.csv
    Commands	perl ../scripts/geneLevel.pl test.clusters.csv ../files/gencode.vM2.chr_patch_hapl_scaff.annotation.gtf > test.gene_cl.csv
    Outputs	test.gene_cl.csv
    Execution Time	2017-9-26 18:25:12 (0.618 seconds)

14. annotateGroups ✓

    Inputs	test.groups
    Commands	../scripts/annotate.pl -g ../files/gencode.vM2.chr_patch_hapl_scaff.annotation.gtf -p ../scripts/annotationRank.txt -r ../files/hg19_rmsk.bed.gz -s ../files/hg19_rmsk_info -strict -oi test.groups | ../scripts/PARclusters2bed.py > test.groupbed
    Outputs	test.groupbed
    Execution Time	2017-9-26 18:25:12 - 2017-9-26 18:25:30 (17.585 seconds)

15. addInfoGroups ✓

    editClustersTC.pl v2.0

    Inputs	test.readbed test.groupbed
    Commands	intersectBed -a test.readbed -b test.groupbed -wao -s | awk -F " " 'BEGIN{OFS=",";} { print $5,$7,$8,$9,$11,$12}' | sed '/,\-1/d' | ../scripts/editClustersTC.pl > test.groups.csv
    Outputs	test.groups.csv
    Execution Time	2017-9-26 18:25:30 - 2017-9-26 18:25:31 (1.442 seconds)

16. geneLvlGroups ✓

    geneLevel.pl v1.0

    Inputs	test.groups.csv
    Commands	perl ../scripts/geneLevel.pl test.groups.csv ../files/gencode.vM2.chr_patch_hapl_scaff.annotation.gtf > test.gene_gr.csv
    Outputs	test.gene_gr.csv
    Execution Time	2017-9-26 18:25:31 (0.805 seconds)

17. statsTable ✓

    Inputs	test.readbed
    Commands	../scripts/extractDataTC.pl test > test.clusters.txt
    Outputs	test.clusters.txt
    Execution Time	2017-9-26 18:25:32 - 2017-9-26 18:25:33 (1.094 seconds)

18. spatialPerl ✓

    Inputs	test.readbed
    Commands	perl ../scripts/Spatial.pl -g ../files/gencode.vM2.chr_patch_hapl_scaff.annotation.gtf -a test -strict -t ../files/isoforms.fpkm_tracking
    Outputs	tmp_test_spatial.csv
    Execution Time	2017-9-26 18:25:33 - 2017-9-26 18:25:58 (24.325 seconds)

19. spatialR ✓

    Inputs	test.readbed
    Commands	unset TMP; unset TEMP; TEMPDIR="/tmp/47609700210084528-0" setsid Rscript - <<'!' yn<-'n' fn<-'test' resolution<-3 install.packages('../scripts/colorRamps_2.3.tar.gz', lib='../scripts/') install.packages('../scripts/schoolmath_0.4.tar.gz', lib='../scripts/') install.packages('../scripts/gtools_3.4.1.tar.gz', lib='../scripts/') install.packages('../scripts/ellipse_0.3-8.tar.gz', lib='../scripts/') install.packages('../scripts/RColorBrewer_1.1-2.tar.gz', lib='../scripts/') install.packages('../scripts/LSD_2.5.tar.gz', lib='../scripts/') library(colorRamps, lib.loc='../scripts/') library(schoolmath, lib.loc='../scripts/') library(gtools, lib.loc='../scripts/') library(ellipse, lib.loc='../scripts/') library(RColorBrewer, lib.loc='../scripts/') library(LSD, lib.loc='../scripts/') library(parallel) source('../scripts/Spatial.R') !
    Outputs	test.readbed
    Execution Time	2017-9-26 18:25:58 - 2017-9-26 18:26:7 (8.902 seconds)